Phaenoglyphis stricta (Thomson, 1877)
publication ID |
https://doi.org/10.3897/BDJ.12.e120950 |
DOI |
https://doi.org/10.5281/zenodo.13820772 |
persistent identifier |
https://treatment.plazi.org/id/29319A64-4A17-589C-A4C6-2ED13F0769EE |
treatment provided by |
|
scientific name |
Phaenoglyphis stricta (Thomson, 1877) |
status |
|
Phaenoglyphis stricta (Thomson, 1877)
Materials
Type status: Other material. Occurrence: recordedBy: Sv. Thygeson & Endrestol; individualCount: 1; sex: male; disposition: in collection; associatedSequences: NOFIG 1005-16; occurrenceID: EF4EB66E-EA90-5319-A693-2C385B87F602; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: stricta ; scientificNameAuthorship: (Thomson, 1877); Location: country: Norway; countryCode: NO; stateProvince: Aust-Agder; municipality: Froland; locality: Jurdalsknuten ; verbatimElevation: 330 m; decimalLatitude: 58.6210; decimalLongitude: 8.2450; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventDate: 2010-8 - 19; year: 1877; Record Level: language: en; institutionID: NINA; collectionID: NOFIG 883; basisOfRecord: PreservedSpecimen
Type status: Other material. Occurrence: recordedBy: Odegaard, Frode; individualCount: 1; sex: female; disposition: in collection; associatedSequences: NOFIG 732-16; occurrenceID: 63646654-B360-5216-8441-B78FD3D7B2F9; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: stricta ; scientificNameAuthorship: (Thomson, 1877); Location: country: Norway; countryCode: NO; stateProvince: Ostfold; municipality: Hvaler; locality: Soendre Sandoey ; verbatimElevation: 14 m; decimalLatitude: 59.0080; decimalLongitude: 11.0830; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventDate: 2014-4 - 25; year: 1877; Record Level: language: en; institutionID: NINA; collectionID: NOFIG 610; basisOfRecord: PreservedSpecimen
Diagnosis
Antennae of both sexes with rhinaria beginning on the last two thirds of F 1, pedicel shorter than F 1, F 1 longer than F 2, F 2 - F 4 subequal in length (Fig. 3 View Figure 3 e); notauli present, scutellar foveae straight laterally, open anteriorly and posteriorly (Fig. 4 View Figure 4 e).
Molecular characterisation
Maximum barcode-distance within species: 0.9 % (2).
Minimum barcode-distance to closest species: 12 % ( P. xanthochroa ).
Consensus barcode sequence (652 bp):
5 ’ - GATATTATATTTTATTTTTGGTGTGTGATCTGGAATAATTGGGTCATCTTTAAGATTAATTATTCGAATAGAATTAGGAACACCAAACCAATTAATCGGAAATGATCAAATTTATAATTCTATTGTTACTGCYCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAGTAGGAGGGTTTGGTAATTATTTAATTCCTTTAATATTATCCGCCCCCGATATAGCTTTCCCTCGTTTAAATAATATAAGATTTTGACTTTTACCTCCTGCTTTATTATTATTAACATCTAGAATATTTATTGATCAAGGGGCTGGAACAGGGTGAACAGTGTATCCTCCTTTATCATCTAATTTAGGTCATTCAGGYATTGCAGTTGATTTAACAATTTTTTCTTTACATATAAGAGGAATTTCATCAATTTTAGGGTCAATTAATTTTATTACAACAATCTTAAATATACGAATTGTTTCAYTAGATAAAATTTCTTTATTTATTTGATCCATTTTTTTAACAACAATTTTATTGTTATTATCTTTACCAGTATTAGCTGGAGGTATTACTATATTACTTTTTGATCGAAATTTAAATACYTCTTTTTTTGACCCTATAGGAGGAGGRGATCCTATTTTATAYCAACATTTATTT- 3 ’
Distribution
Andorra, Denmark, Finland, France, Germany, Mexico: Mexico City, Norway, Russia: Murmansk Oblast, Sweden, United Kingdom: England, and USA: Arizona, Iowa ( Hellén 1963, Ferrer-Suay et al. 2013, Ferrer-Suay et al. 2014, Ferrer-Suay et al. 2023).
Taxon discussion
The specimens with their corresponding barcodes and identification were published prior to this study on BOLD. Though its occurrence in Norway has not been published in a scientific journal, we refrain from claiming to be the first to record the species for Norway, as this information was publicly available prior to this study.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |