Dinapsis igneus van Noort & Shaw, 2022

van Noort, Simon, Shaw, Scott Richard & Copeland, Robert S., 2022, Revision of the endemic African genus Dinapsis (Dinapsini, Megalyridae, Hymenoptera) with description of seven new species, ZooKeys 1112, pp. 27-122 : 27

Dinapsis igneus van Noort & Shaw sp. nov.

Figs 14 , 15 , 16 , 17

Material examined.

Holotype. Mauritius • ♀; Black River Gorges Natl. Pk., Pétrin; 20°24'31"S, 57°28'11"E; 674 m a.s.l.; 7 Dec. 2016; S.A. Marshall leg.; debu00396997; BARCODE BOLD:FSA1893-21; IMAGED WaspWeb LAS 4.9 SAMC 2019; DEBU . Paratypes. Mauritius • 1 ♂; Black River Gorges N.P.; Mare Longue , 20°23'26"S, 57°27'9"E; 619 m a.s.l.; 7-9 Dec. 2016; S.A. Marshall leg.;, debu00396799; Megalyridae Det.: S.M. Paiero 2018; BARCODE BOLD:BOLD:FSA1894-21; IMAGED WaspWeb LAS 4.9 SAMC 2019; DEBU • 1 ♀; Black River, Black River Gorges N.P., Pétrin; 20°24'31"S, 57°28'11"E; 24 Jan.-2 Feb. 2018; 620 m a.s.l.; Kirk-Spriggs & Muller leg.; Malaise trap; upland heath forest; ICIPE • 1 ♂; Black River, Black River Gorges N.P., Mare Longue ; 20°23'26"S, 57°27'09"E; 24 Jan. -2 Feb. 2018; 619 m a.sl.; Kirk-Spriggs & Muller leg.; Malaise trap; Montane rainforest; ICIPE .

Diagnosis.

Dinapsis igneus can be assigned to the Dinapsis oculohirta species group by the presence of dense ocular setae on the eyes. It can be distinguished from D. oculohirta , and others in that group, by being the only Dinapsis species with a slight metallic sheen to the integument (as seen under a microscope with illumination). The mesoscutum has a characteristic strongly raised bilobed crest situated anteriorly (Fig. 15B ); the head and mesosoma has a characteristic weakly metallic greenish bronze sheen (only observable under sufficient illumination) and is densely rugulose-punctate and covered with dense white setae (Fig. 16E ). The latter character states are also not present in any other species, which are non-metallic, black, or brown, or rarely with orange patches, have a mesosoma which is often smooth, sometimes with scattered foveae, if sculptured then the integument is broadly foveate, and the mesosoma is often semi-glabrous, and only ever sparsely covered with setae.

Distribution.

(Fig. 43 ) Mauritius.

Comments.

Known only from Black River Gorges National Park in both the montane rainforest and upland heath forest habitat. This is the first megalyrid species to be described from an island that is volcanic in origin, and not a more ancient fragment of continental rock. Previous authors have commented on the association of Megalyridae with ancient continental landmasses ( Shaw 1990b; Vilhelmsen et al. 2010). This raises interesting questions about whether this species is derived from megalyrid ancestors that dispersed naturally to the island in ancient times (perhaps by drifting in wood with infected host insects), or whether the species might have been accidentally transported to the island by human commerce, either from Madagascar or the African mainland, in the last 500 years. We expect it will be found from Africa or Madagascar eventually, unless it is extirpated in those places.

Etymology.

This species is named after the Latin for fiery (igneus) in reference to the provenance of the species from Mauritius, which is a volcanic island formed ca. 8 million years ago. The species epithet is to be treated as an adjective.

Barcode sequence for holotype female.

38754_A01_Din_ign_fem (sequence code in BOLD: FSA1893-21) BIN URI: None (sequence too short).

Nucleotide sequence for holotype female.

CTATAAGAATAATTATTCGTATGGAACTTAGAGTTCCGGGTTCATTTATTGGAAATGATCAGATTTATAATTCTATTGTGACTGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCTTTTATAATGGGAGGTTTTGGTAATTGGTTATTGCCCTTAATGTTAGGGGCTCCTGATATGTCTTACCCTCGTCTTAATAATTTAAGGTTTTGATTGTTGGTTCCTTCTTTGTTATTTTTATTAATA.

Barcode sequence for paratype male.

38754_A02_Din_ign_mal (sequence code in BOLD: FSA1894-21) BIN URI: None (sequence too short).

Nucleotide sequence for paratype male.

TTGAGCAGGGCTTATTGGATCATCTATAAGAATAATTATTCGTATGGAACTTAGAGTTCCGGGGTCATTTATTGGGAATGATCAGATTTATAATTCTATTGTAACTGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCTTTTATAATGGGAGGGTTTGGTAATTGATTATTGCCTTTGATGTTAGGGGCCCCTGATATGTCTTATCCTCGTCTTAATAATTTAAGGTTTTGATTATTGGTTCCTTCTTTGTTATTTTTACTAATAAGGTTTTATGTGGGCAGAGGTACAGGAA.

Description.

Holotype female. Body length 4.0 mm excluding ovipositor.

Colour. Head and mesosoma with greenish bronze sheen. Head with a dense covering of white setae on occiput, darker, more widely spaced setae on face and frons; mesoscutal plate with a greenish bronze sheen. Mesoscutal plate with anteriodorsal bilateral peaks. Anteriolateral mesoscutal knobs absent; metasoma brown, lighter yellowish brown along posterior tergal margins. Scape, pedicel, F1, fore coxae and mid coxae, tibiae and tarsi yellowish brown. F2 and F3 light brown; F4 to F12 dark brown with light offset rows of multiporous plate sensilla; trochanters whitish yellow. Hind femur dark brown, except for light yellowish brown apex. Ovipositor orange-brown. Eyes and ocelli silvery. Wing membrane clear without dark bands.

Head round, only slightly (1.13 ×) wider than high; vertex, frons, and face evenly strongly punctate, interstices polished, 1-2 × greater than puncture width; ocelli small, OOL 2.0 × ocellar diameter; all ocelli bounded by a semi-circular depression on the side facing outer edge of the triangle; ocellar triangle isosceles (POL:LOL - 3:4); eye large and hardly protuberant, not parallel in anterior view, strongly diverging dorsally and ventrally; eye densely and evenly covered with minute white ocular setae; eye margined posteriorly by foveate groove; postocular orbital carina weakly present; antenna with 12 flagellomeres having flagellar length/width ratios as follows: F1 = 5, F2-F4 = 4.0, F5-F9 = 2.5, F10-F11 = 2.2 F12 = 2.75; apical flagellomeres distinctly wider than basal flagellomeres; temple adjacent to ocular orbital carina coarsely rugulose, temple width 0.67 × eye width in lateral view; malar length equivalent to mandible width basally; occiput coarsely rugulose; occipital carina wide laterally, narrower dorsally and crenulate.

Mesosoma. Pronotum polished, laterally excavated with a row of large quadrate to oblong foveae situated posteriorly on the margin with the mesopleuron; foveae along dorsolateral margin faint and shallow; medially with angled central row of six foveae, dorsal fovea largest, 3 × length of others. Mesoscutal anterior plate polished, with a medial suture grading ventrally into a row of approximately five foveae, and lateral carinae bounded by weak foveae; glabrous except for dorsal fifth which is setose as in rest of mesoscutum; mesoscutum 1.1 × wider than long, shoulders rounded, mesoscutal lobes absent; medially mesoscutum punctate; medial mesoscutal furrow deep, narrow with weakly jagged edge; transscutal articulation a smooth, narrow furrow, anterior edge weakly jagged, posterior edge straight; scutoscutellar sulci medially comprising a continuous shallow groove with defined foveae; anteriorly meeting before reaching transscutellar articulation; scutellar disc punctate; mesonotum dorsally covered with dense white setae; mesopleuron antero-laterally shallowly foveate, dorsal fovea elongate, extending entire dorsal length of mesopleuron, with short white setae except for medially polished area surrounding large median mid-pit. Metanotum with raised, setose (long white setae as on mesoscutum) medial area flanked laterally by depression with 3-5 foveae. Propodeum medially polished with strong transverse carinae between the submedian longitudinal carinae defining the three central tracks; lateral longitudinal tracks with defined transverse carinae. All five tracks anteriorly with two or three deep foveae.

Legs. All legs with long, white setae, each seated in a darker basal socket, contrasting with surrounding pale integument creating weakly spotted appearance. Apex of fore tibia with comb of stout spines; hind coxa polished, with sparse, shorter, white setae; hind femur stout, polished, 2.3 × longer than wide, outer surface of hind femur sparsely covered with short, white setae; inner surface of hind femur polished with very short setae; surface of hind tibia polished, with long, erect white setae dorsally and ventrally, shorter setae laterally; dorsal setae lacking spatulate tips; inner ventral margin of hind tibia with a dense longitudinal patch of shorter white setae; hind basitarsus long, 1.5 × length of remaining four tarsomeres combined; basitarsus ventrally with dense preening brush consisting of numerous short, brown setae, inclined posteriorly; basitarsus dorsally with normal long, white setae, lacking spatulate tips; T2 twice as long as wide, T3 1.3 × longer than wide, T4 ca. as long as wide, T5 ca. 4 × as long as wide; all tarsomeres with normal hair-like setae, but also with scattered elongate, stronger setae projecting from dorsal surface; tarsal claw simple, strongly curved.

Wings. Forewing length 3.1 mm, 3 × longer than wide; wing surface evenly covered with small, scattered setae, including basal cells R and 1A; wing clear, without dark vertical bands. Forewing venation with vein Rs apically curving abruptly towards anterior wing margin to form short, truncate marginal cell 2R1; apical segment of vein M abbreviated, not extending beyond apex of marginal cell, vein M with small white bulla situated at a quarter of vein length. Hind wing with apical stub of vein Rs 2/3 of shortest width between the propodeal submedian longitudinal carinae.

Metasoma in lateral view 1.75 × as long as wide, with seven dorsally visible terga, all polished; exposed portion of ovipositor relatively short, in lateral view 0.76 × metasomal length; dorsal valve with 14 serrations, ventral valve smooth; ovipositor sheaths setose, strongly curled (an artefact of preservation).

Variation.

Paratype male has body length 3.75 mm, and forewing length 3.0 mm.

Figures

Figure 14. Dinapsis igneus van Noort & Shaw, sp. nov. holotype female (DEBU) A habitus, dorsal view B habitus, lateral view C head, mesosoma, lateral view D head, mesosoma, dorsal view E head, dorsal view F antennae, lateral view. Scale bars: 1000 µm (A, B); 200 µm (C, E, F); 500 µm (D).

Figure 15. Dinapsis igneus van Noort & Shaw, sp. nov. holotype female (DEBU) A head, anterior view B mesoscutum, anterior view C mesosoma, dorsal view D hind leg, anti-axial view E metasoma, lateral view F wings, dorsal view (inset: data labels). Scale bars: 200 µm (A, D, E); 100 µm (B, C); 500 µm (F).

Figure 16. Dinapsis igneus van Noort & Shaw, sp. nov. paratype male (DEBU) A habitus, dorsal view B habitus, lateral view C head, mesosoma, dorsal view D head, mesosoma, lateral view E head, dorsoposterior view F metasoma, lateral view. Scale bars: 500 µm (A, B); 200 µm (C, D, E, F).

Figure 17. Dinapsis igneus van Noort & Shaw, sp. nov. paratype male (DEBU) A head, anterior view B mesoscutum, anterodorsal view C mesosoma, dorsal view D hind leg, antiaxial view (inset: data labels) E metasoma terminal tergites and pygostyle, dorsal view F wings, dorsal view. Scale bars: 200 µm (A, D); 100 µm (B, C, E); 500 µm (F).

Figure 43. Distribution maps of Dinapsis species A country occurrences for the genus Dinapsis B specimen point data of described Dinapsis species plotted on a topographical relief map C Dinapsis species occurring in Madagascar and Mauritius, excluding the D. hirtipes species-group (specimen point data plotted on a topographical relief map) D Madagascan records of Dinapsis species in the D. hirtipes species group (specimen point data plotted on a topographical relief map).