Latouchia yaoi Hao, Yu & Zhang, 2025

Hao, Long, Yu, Kun & Zhang, Feng, 2025, Description of five new species from southern China, with note on the type species of Latouchia Pocock, 1901 (Araneae, Halonoproctidae), Biodiversity Data Journal 13, pp. e 137852-e 137852 : e137852-

publication ID

https://doi.org/ 10.3897/BDJ.12.e137852

publication LSID

lsid:zoobank.org:pub:2626A1F9-100B-4C92-9740-6C3DBED9A947

DOI

https://doi.org/10.5281/zenodo.14587186

persistent identifier

https://treatment.plazi.org/id/51128E69-0B84-58EA-87D5-1AF16401264F

treatment provided by

Biodiversity Data Journal by Pensoft

scientific name

Latouchia yaoi Hao, Yu & Zhang
status

sp. nov.

Latouchia yaoi Hao, Yu & Zhang sp. nov.

Materials

Type status: Holotype. Occurrence: recordedBy: K. Yu & Y. Liang; sex: male (raised by L. Hao and matured in September 2023); occurrenceID: 9F849FFB-0671-5D0F-B87E-2D3C9385C159; Taxon: scientificName: Latouchia yaoi sp. nov.; Location: country: China; stateProvince: Shaanxi; county: Hanzhong; locality: Wuxiang Town, near Tiantai National Forest Park ; verbatimElevation: 859 m; verbatimCoordinates: 33.2450 ° N, 107.0528 ° E; Identification: identifiedBy: L. Hao; Event: eventDate: 28 January 2023; Record Level: institutionCode: MHBU-ARA- 10000056; KYUARA # 1984 GoogleMaps

Type status: Paratype. Occurrence: recordedBy: K. Yu & Y. Liang; sex: female; occurrenceID: 293B63F8-DB8B-510B-AACE-DF988169EB45; Taxon: scientificName: Latouchia yaoi sp. nov.; Location: country: China; stateProvince: Shaanxi; county: Hanzhong; locality: Wuxiang Town, near Tiantai National Forest Park ; verbatimElevation: 859 m; verbatimCoordinates: 33.2450 ° N, 107.0528 ° E; Identification: identifiedBy: L. Hao; Event: eventDate: 7 February 2023; Record Level: institutionCode: MHBU-ARA- 10000057; KYUARA # 0059 GoogleMaps

Type status: Paratype. Occurrence: recordedBy: K. Yu & Y. Liang; sex: female; occurrenceID: D467B434-D070-576A-B5C7-626D290DE468; Taxon: scientificName: Latouchia yaoi sp. nov.; Location: country: China; stateProvince: Shaanxi; county: Hanzhong; locality: Wuxiang Town, near Tiantai National Forest Park ; verbatimElevation: 859 m; verbatimCoordinates: 33.2450 ° N, 107.0528 ° E; Identification: identifiedBy: L. Hao; Event: eventDate: 7 February 2023; Record Level: institutionCode: MHBU-ARA- 10000058; KYUARA # 0060 GoogleMaps

Type status: Paratype. Occurrence: recordedBy: K. Yu & Y. Yang; sex: female; occurrenceID: B46D3ADD-607F-58D8-A457-0888958F1B16; Taxon: scientificName: Latouchia yaoi sp. nov.; Location: country: China; stateProvince: Shaanxi; county: Hanzhong; locality: Shengshui Town, Majiazui Village, near Shengshui Temple ; verbatimElevation: 540 m; verbatimCoordinates: 33.0351 ° N, 107.1120 ° E; Identification: identifiedBy: L. Hao; Event: eventDate: 28 April 2020; Record Level: institutionCode: MHBU-ARA- 10000059; KYUARA # 1986 GoogleMaps

Description

Male (Holotype, MHBU-ARA- 10000056). Colouration in ethanol (Fig. 13 View Figure 13 A; for colouration of living holotype male, see Fig. 12 View Figure 12 C). Carapace yellowish-brown, chelicerae darker than carapace, with eye mound, fovea and outer edge of carapace darker; area between eye mound and fovea with two slightly darker longitudinal colour bands. Legs yellowish-brown, with femora gradually transitioning to slightly deeper hue from proximal to distal, darker than rest of legs. Opisthosoma: dorsal side grey, with distinct dark pattern; ventral side with dense black fur, slightly darker than dorsal side; booklung covers yellow. Ventral side of whole body generally brighter than dorsal side; sigilla slightly darker than rest of sternum (Fig. 13 View Figure 13 C).

Total length 10.07. Carapace 5.21 long, 4.60 wide; opisthosoma 4.84 long, 3.59 wide. Eye group 0.47 long, 0.53 wide anteriorly, 0.65 wide posteriorly; MOA 0.35 long, front width 0.23, back width 0.45. Eye diameters and interdistance: AME 0.14, ALE 0.16, PME 0.12, PLE 0.17, AME – AME 0.12, AME – ALE 0.11, ALE – PLE 0.15, PME – PME 0.35, PME – PLE 0.03. Palpal coxa 1.78 long, 1.01 wide, bearing 11 / 14 spinules on prolateral-proximal corner. Sternum 3.04 long, 2.63 wide. Labium 0.43 long, 0.84 wide, without cuspule or spinule. Chelicerae without stridulatory ridges; rastellum of left and right chelicerae carrying six and five stout spines, respectively; chelicerae groove with 5 / 5 and 3 / 3 teeth of different sizes on promargin and retromargin, respectively.

Leg formula 4123; measurements: Ⅰ 13.59 (3.35, 1.49, 3.68, 3.12, 1.95), II 12.78 (3.40, 1.24, 3.33, 3.10, 1.71), III 11.80 (2.81, 1.06, 2.48, 3.13, 2.32), IV 17.96 (5.47, 2.26, 4.30, 3.91, 2.02). Spines on femora to metatarsi of legs I – II straight, sword-like (typical); spines on the prolateral patellae of leg I-II typical, ventrally strong on leg I (especially distally), tip hooked, but absent on leg II; spines on prolateral tibiae of legs I few, absent on leg III, except apically, ventrally more elongate and expansive on both legs, two especially elongate adjacent spines proximally on leg II (Fig. 15 View Figure 15 D and Fig. 16 c View Figure 16 c ). Spination of leg I, patellae, Drv (3) / (1-3), Mpd (1-1 - 2) / (1-1 - 2), Mpv (1-1 - 1) / (1-1 - 2); tibiae, Mp (1-1 - 2 - 1 - 1) / (1-1 - 1 - 1 - 2), rv (2-2 - 2 - 1 - 3) / (1-2 - 2 - 2 - 3); metatarsi, Dpv (2) / (1), rv (1-1 - 1 - 1) / (1-1 - 1 - 1). Spination of leg II, patellae, Dpd (1-2) / (1-3), Drd (2) / (2); tibiae, Dp (2) / (1), Pv (3) / (3), Dv (1) / (1); metatarsi, Mrv (1) / (1-1). Tibia III unmodified. Trichobothria of legs present on proximal one-third part of tibiae I – II, half of tibiae III, proximal one-fourth part of tibia IV, distal half of metatarsi I – III, distal two-thirds part of metatarsus IV and dorsal side of all tarsi; trichobothria on tibiae I – IV and metatarsi I – IV unmodified; trichobothria on tarsi I – III divided into unmodified and clavate forms, with former irregularly distributed across almost entire dorsal surface and latter only present in proximal half, clavate form of trichobothria not observerd on tarsi IV. Count of trichobothria on legs: I, tibia 5 / 3 pd and 4 / 5 rd, metatarsus 8 / 8, tarsus 10 / 10 unmodified and 4 / 4 clavate; II, tibia 5 / 5 pd and 5 / 5 rd, metatarsus 9 / 9, tarsus 3 / 10 unmodified and? / 4 clavate; III, tibia 4 / 4 pd and 5 / 3 rd, metatarsus 8 / 8, tarsus 18 / 15 unmodified and 3 / 2 clavate; IV, tibia 5 / 6 pd and 3 / 6 rd, metatarsus 5 / 5, tarsus 12 / 11 unmodified. Tarsal claws: paired claws with 8–10 teeth (Fig. 15 View Figure 15 F); unpaired claw bare, without denticle.

Palp 6.35 long (2.57, 1.08, 2.11, 0.59). Trichobothria on palpal tibia unmodified, present on proximal one-third part, on cymbium divided into unmodified and clavate forms, with latter occupying majority of trichobothrial area, while former sparsely distributed at distal end of trichobothrial area; count of trichobothria: tibia 4 / 4 pd, 4 / 2 rd cymbium, 4 / 3 unmodified and 5 / 5 clavate. Tibia cylindrical, transitioning to slightly narrow from proximal to distal, the distal end is half the thickness of the proximal end, with one lyriform organ on ventro-prolateral side of sub-distal part. Short strong spines of palp tibia, Mp (1-2 - 1 - 2 - 2 - 1 - 1) / (1-2 - 1 - 1 - 2 - 1), Mr (2-3 - 2 - 1 - 1) / (1-1 - 3 - 2 - 2 - 1), Drv (2) / (2). Palpal organ: tegulum oval (Fig. 14 View Figure 14 A – C); embolus base thick, the length of embolus approximately 1.5 times the width of tegulum, with one distally elevated embolic keel extending from retrolateral side of sub-basal part of embolus to dorsal side of sub-distal part; embolic keel smooth; apex of embolus slender, gradually tapering to sharp tip (Fig. 13 View Figure 13 H).

Female (Paratype, MHBU-ARA- 10000057). Colouration in ethanol (Fig. 13 View Figure 13 B; for colouration of living paratype fermale, see Fig. 12 View Figure 12 D). Carapace like male, but slightly darker, eye mound and fovea darker; chelicerae yellowish-brown similar to carapace. Colour between palp and each leg without significant difference, overall similar in colour to carapace. Opisthosoma: dorsal side colour like male, but slightly lighter, with distinct dark pattern. Ventral side of whole body generally brighter than dorsal side; booklung covers paler than remaining ventral side. Palpal coxa and labium slightly darker, sigilla lighter than rest of the sternum (Fig. 13 View Figure 13 D).

Total length 14.17. Carapace 5.99 long, 4.65 wide; opisthosoma 8.17 long, 5.46 wide. Eye group 0.62 long, 0.46 wide anteriorly, 0.78 wide posteriorly; MOA 0.46 long, front width 0.27, back width 0.47. Eye diameters and interdistance: AME 0.13, ALE 0.29, PME 0.18, PLE 0.28, AME – AME 0.18, AME – ALE 0.17, ALE – PLE 0.16, PME – PME 0.32, PME – PLE 0.10. Palpal coxa 2.05 long, 1.23 wide, bearing 15 / 18 cuspules on prolateral-proximal corner. Sternum 3.62 long, 3.31 wide. Labium 0.97 long, 1.27 wide, without spinules or cuspule. Chelicerae without stridulatory ridges; rastellum of left and right chelicerae carrying six and seven stout spines, respectively; chelicerae groove with 5 / 5 and 3 / 3 teeth of different sizes on promargin and retromargin, respectively.

Leg formula 4123; measurements: Ⅰ 11.27 (3.92, 2.10, 2.61, 1.50, 1.14), II 9.53 (3.38, 1.73, 1.65, 1.58, 1.19), III 7.93 (2.64, 1.48, 1.17, 1.41, 1.23), IV 13.24 (4.25, 1.94, 2.61, 2.65, 1.79). Spines of legs I – II primarily distributed on p, pd, r and rv of tibia, as well as p, pv, r and rv of metatarsus and tarsus; the tip of most spines weakly curved downwards, forming slight hook-shape; some spines on rv longer and not curved at tip. Leg III strong; groups of short strong spines on apical and prodorsal sides of patella; tibia III shortened, without demi-saddle shape; metatarsus with numerous short, strong spines closely grouped in dorsal area, slender spines on ventro-distal. Groups of short strong spines on prolateral patella and slender spines on ventral metatarsus of Leg IV. Tarsus III – IV with ventro-distal group of stiff bristles and few slender spines. Trichobothria of legs present on proximal one-third part of tibiae I – III, proximal half part of tibia IV, distal half of metatarsi I – IV and proximal two-thirds of all tarsi; trichobothria on tibiae I – IV and metatarsi I – IV unmodified; trichobothria on tarsi I – III divided into unmodified and clavate forms, with latter only present in proximal half of tarsus, trichobothria on tarsi IV without clavate forms. Count of trichobothria on legs: I, tibia 4 / 4 pd and 5 / 3 rd, metatarsus 8 / 6, tarsus 13 / 11 unmodified and 5 / 4 clavate; II, tibia 4 / 5 pd and 4 / 4 rd, metatarsus 9 / 7, tarsus 8 / 7 unmodified and 4 / 4 clavate; III, tibia 4 / 4 pd and 5 / 4 rd, metatarsus 5 / 5, tarsus 12 / 9 unmodified and 3 / 3 clavate; IV, tibia 7 / 6 pd and 6 / 6 d, metatarsus 7 / 6, tarsus 12 / 14 unmodified. Tarsal claws: all paired claws with two teeth (Fig. 15 View Figure 15 G); unpaired claw bare, without denticle. Palp 10.04 long (3.76, 1.44, 2.28, 2.56), spines on palp distributed on p, pv, r and rv of tibia and tarsus; palpal tarsal claw with one basal tooth.

Vulva (Fig. 13 View Figure 13 I and Fig. 15 View Figure 15 E). Two separate sperm receptacles connected to atrium via slender stalk, stalk inwardly inclined, sperm receptacles nearly spherical, tilted outwards at approximately 45 °. Tan glandular pores present on distal two-thirds of stalk and entire sperm receptacle. Glandular pores also present on basal one-third of stalk, atrium, as well as uterus externus.

Diagnosis

The male similar to Latouchia wenchuan sp. nov. For the differences, see Latouchia wenchuan sp. nov.. The male can be easily distinguished from the geographically close L. jinyun sp. nov. by whether spines are present on the palpal tibia.

Etymology

The specific epithet is in honour to Mr. Yao Yang, a good friend of the second author who, together with the second author, collected the first specimen of this new species.

Distribution

Known only from the type locality of Shaanxi, China (Fig. 17 View Figure 17 ).

Biology

The burrows of this species were found on slopes along roadsides or small riverbanks (Fig. 12 View Figure 12 A and B). The rim of the burrow entrance is sometimes adorned with dried plant materials (Fig. 12 View Figure 12 E – G). The holotype male was matured in September in captivity; some females from Wuxiang Town were observed carrying spiderlings (likely to be third instar) in late January, even though the temperature at the time was only between minus one and seven degrees Celsius. Some individuals have been observed exhibiting self-burying behaviour in captivity, which involves filling the burrow with soil, leaving just enough space at the bottom of the burrow to accommodate their bodies and living within this confined space. This behaviour typically occurs after a substantial meal, although the purpose remains unclear; the longest observed period for a female in this state was over 40 days.

DNA barcode

AAAGATATTGGAACTTTGTATATAATTTTTGGGGTGTGGTCGGCTATGGTAGGGACTGCAATAAGAGTAATCATTCGAATTGAGCTTGGACAAGTTGGAAGATTATTTGGTGATGATCATTTATATAATGTTGTTGTTACTGCTCATGCTTTAGTTATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGCTTTGGAAATTGACTGCTTCCAATAATAATTGGTTGTCCAGATATAGCTTTTCCACGAATGAATAATTTAAGATTTTGATTGCTTCCTCCTTCTCTGTTTTTGCTTTTGTTGTCTTCTATAACAGATGTCGGAGTGGGTGCCGGTTGAACTATTTATCCTCCTTTGTCTTCTGAACTTGGCCATAGAGGTGGAGGGATAGATTTTGCTATTTTTTCTCTTCATTTGGCTGGTGGGTCTTCGGTGATGGGTTCTATTAATTTTATTTCTACAATTTTAAATATGCGTCCTTTTGGAATGATAATGGAGCGAGTTCCTTTATTCGTGTGATCTGTATTAATTACTACTATTTTATTGTTATTATCTTTACCTGTATTGGCTGGGGCTATTACCATATTATTAACTGATCGAAATTTTAATACTTCGTTTTTTGATCCTGCTGGTGGGGGGGATCCTGTGTTGTTTCAGCATTTGTTTTGATTTTTTGGTCA (GenBank accession number: PQ 585636).

Kingdom

Animalia

Phylum

Arthropoda

Class

Arachnida

Order

Araneae

Family

Halonoproctidae

Genus

Latouchia