Anacharis immunis Walker, 1835

Vogel, Jonathan, Forshage, Mattias, Bartsch, Saskia B., Ankermann, Anne, Mayer, Christoph, von Falkenhausen, Pia, Rduch, Vera, Müller, Björn, Braun, Christoph, Krammer, Hans-Joachim & Peters, Ralph S., 2024, Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species, Journal of Hymenoptera Research 97, pp. 621-698 : 621-698

Anacharis immunis Walker, 1835

Figs 2 B , 3 B , 11 A – E

Anacharis immunis Walker, 1835: 521 - lectotype ( NHMUK) ♂, syn. by Fergusson (1968), photographs examined.

Anacharis staegeri Dahlbom, 1842: 4 - lectotype ( MZLU) ♀, syn. by Dalla Torre (1893), photographs examined.

Synapsis aquisgranensis Förster, 1869: 361 - Holotype ( ZMHB) ♂, syn. by Kierych (1984), not examined.

Diagnosis

(n = 14). Belongs to the immunis species group. Anacharis immunis can be distinguished from A. ensifer and A. norvegica by having a largely smooth and even dorsal surface of the mesoscutellum, especially centrally (reticulate-foveate in A. ensifer and A. norvegica ) (Fig. 11 D ). The fore and mid coxae are usually as dark as the hind coxa (usually distinctly paler than the hind coxa in A. ensifer ).

CO 1 barcode.

n = 14. Maximum intraspecific distance = 0.2 %. Minimum distance to closest species ( A. ensifer ) = 7.8 %. CO 1 barcode consensus sequence:

AATTTTATACTTTATTATAGGAATCTGATCAGCAATATTAGGATCAAGACTTAGTATAATTATCCGAAT AGAATTAGGGACTCCATCACAATTAATTAGAAATGAACAAATTTACAATTCAATTGTAACCGCACATGCA TTTATCATAATTTTTTTTATAGTTATACCTATTATAGTAGGAGGATTTGGAAATTACCTAATCCCATTAA TACTTTTATCTCCAGATATAGCTTTTCCACGATTAAATAATATAAGATTTTGATTTTTAATTCCCTCTTT AGCTTTAATATCTTCTAGTTTATTTATTGATCAAGGGGCAGGAACAGGATGAACAATTTACCCTCCTTTA TCTTCATTAACAGGACACTCAGGAATTGCAGTAGATATAACAATCTACTCCCTTCATTTAAGAGGAATTT CTTCAATTTTAGGATCAATTAATTTTATCAGAACAATTTTAAACATACGAATTAATAAAGTATCAATAGA TAAAATTACTCTATTTAGATGATCAATCTTTTTAACTACAATTTTATTACTTCTATCATTACCTGTGCTT GCAGGAGGAATTACTATACTTTTATTTGACCGAAACTTAAACACCTCCTTTTTCGACCCCATAGGGGGAG GAGACCCAATCTTATATCAACATTTATTT

Type material.

Lectotype of A. immunis Walker, 1835 :

Type

immunis, Walk. [handwritten, probably by Walker himself]

In coll under immunis

LECTOTYPE

B. M. TYPE HYM 7. 160

LECTOTYPE of A. immunis Walker det. N. D. M. Fergusson, 1981

[QR code] NHMUK 010640455

[for images, see https://data.nhm.ac.uk/dataset/56e711e6-c847-4f99-915a-6894bb5c5dea/resource/05ff2255-c38a-40c9-b657-4ccb55ab2feb/record/10638963]

Lectotype of A. staegeri Dahlbom, 1842 :

♀

LECTOTYPE

LECTOTYPE of Anacharis staegeri Dahlm det. N. D. M. Fergusson, 1983

1983 366

MZLU 00215544

MZLU Type no. 6511: 1

[for images, see https://www.flickr.com/photos/tags/mzlutype06511]

Other material examined.

DNA barcode vouchers. Germany • 1 ♀; Baden-Württemberg, Karlsruhe, Malsch, Hansjakobstraße , garden; 48.8835 ° N, 8.3197 ° E; ca 120 m a. s. l.; 25 Oct. - 8 Nov. 2020; Dieter Doczkal leg.; Malaise trap; ZFMK -TIS-2640725 . • 1 ♀; Bavaria, Allgäu, Balderschwang, Leiterberg ; 47.4858 ° N, 10.0899 ° E; ca 1290 m a. s. l.; 4–21 Sep. 2017; Doczkal, Dieter, Voith, J. leg.; Malaise trap; ZFMK -TIS-2640709 . • 1 ♀; Bavaria, Garmisch-Partenkirchen, Zugspitze , mountain; 47.4068 ° N, 11.008 ° E; ca 2010 m a. s. l.; 20 Jun. - 5 Jul. 2018; Doczkal, D., Voith, J. leg.; Malaise trap; ZFMK -TIS-2628218 . • 6 ♂♂; Bavaria, Rhön-Grabfeld, Fladungen, Nat. res. Schwarzes Moor , Karpatenbirkenwald ; 50.5117 ° N, 10.071 ° E; ca 780 m a. s. l.; 26 Jun. - 18 Jul. 2017; Dieter Doczkal leg.; Malaise trap; ZFMK -TIS-2629533 , ZFMK -TIS-2629534 , ZFMK -TIS-2629535 , ZFMK -TIS-2629536 , ZFMK -TIS-2629537 , ZFMK -TIS-2629539 . • 2 ♂♂; Hesse, Waldeck-Frankenberg, NP Kellerwald-Edersee, „ Banfe-Haus “; 51.167 ° N, 8.9749 ° E; ca 270 m a. s. l.; 7–21 Jul. 2022; GBOL III leg.; Malaise trap; ZFMK -TIS-2640756 , ZFMK -TIS-2640759 . • 3 ♂♂; Rhineland-Palatinate, Ahrweiler, Niederzissen, Bausenberg , upper part of volcanic mountain, next to oak tree; 50.4672 ° N, 7.2212 ° E; ca 310 m a. s. l.; 12–27 Jul. 2022; Jaume-Schinkel, Santiago leg.; Gressit Malaise trap; ZFMK -TIS-2640771 , ZFMK -TIS-2640772 , ZFMK -TIS-2640773 .

Material without DNA barcode. Belgium • 1 ♂; Walloon Brabant, Ottignies ; 9–16 Jul. 1983; Paul Dessart leg.; Malaise trap; JV_Prel_0073 ( RBINS) . • 1 ♀; same collection data as for preceding 24 Sep. - 1 Oct. 1983; JV_Prel_0051 ( RBINS) . • 1 ♀; Walloon Region, Luik, Wanze, Antheit (Corphalie); 50.5363 ° N, 5.2515 ° E; ca 110 m a. s. l.; 16–30 May 1989; R. Detry leg.; Blue pan trap; JV_Prel_0056 ( RBINS) .

Denmark • 1 ♂; Eastern Jutland , Fugslev; 56.2667 ° N, 10.7167 ° E; ca 20 m a. s. l.; 1999; Torkhild Munk leg.; NHRS - HEVA 000023102 ( NHRS) . • 4 ♂♂; Eastern Jutland, Hjelm ; 3–5 Aug. 1992; Torkhild Munk leg.; NHRS - HEVA 000023104 ( NHRS), NHRS - HEVA 000023104 ( NHRS), NHRS - HEVA 000023104 ( NHRS), NHRS - HEVA 000023105 ( NHRS) . • 1 ♂; Eastern Jutland, Rugård, Sønderskov ; 56.2667 ° N, 10.8167 ° E; ca 30 m a. s. l.; 20 Jul. 1996; Torkhild Munk leg.; NHRS - HEVA 000023103 ( NHRS) . • 1 ♀, 1 ♂; Northwestern Jutland, Torup , klitplantage; 56.9667 ° N, 8.4 ° E; ca 20 m a. s. l.; 27 Jul. 1989; Torkhild Munk leg.; female - NHRS - HEVA 000023106 ( NHRS); male - NHRS - HEVA 000023101 ( NHRS) .

Germany • 1 ♀; Bavaria, Garmisch-Partenkirchen, Zugspitze , mountain; 47.4053 ° N, 11.0091 ° E; ca 1980 m a. s. l.; 2–13 Aug. 2018; Dieter Doczkal | Johannes Voith leg.; Malaise trap; ZFMK -HYM-00039683 . • 3 ♂♂; Rhineland-Palatinate, Ahrweiler, Niederzissen, Bausenberg , slope of volcanic mountain, mixed broad-leaved forest; 50.4679 ° N, 7.2223 ° E; ca 330 m a. s. l.; 12–27 Jul. 2022; Santiago Jaume Schinkel leg.; Gressitt Malaise trap; ZFMK -HYM-00039684 , ZFMK -HYM-00039685 , ZFMK -HYM-00039686 . • 18 ♂♂; Rhineland-Palatinate, Ahrweiler, Niederzissen, Bausenberg , upper part of volcanic mountain, next to oak tree; 50.4672 ° N, 7.2212 ° E; ca 310 m a. s. l.; 12–27 Jul. 2022; Santiago Jaume Schinkel leg.; Gressitt Malaise trap; ZFMK -HYM-00039689 , ZFMK -HYM-00039690 , ZFMK -HYM-00039691 , ZFMK -HYM-00039692 , ZFMK -HYM-00039693 , ZFMK -HYM-00039694 , ZFMK -HYM-00039695 , ZFMK -HYM-00039696 , ZFMK -HYM-00039697 , ZFMK -HYM-00039698 , ZFMK -HYM-00039699 , ZFMK -HYM-00039700 , ZFMK -HYM-00039701 , ZFMK -HYM-00039702 , ZFMK -HYM-00039703 , ZFMK -HYM-00039704 , ZFMK -HYM-00039705 .

Sweden • 1 ♀; Närke, Örebro, Adolfsberg ; 19 Sep. 1953; Anton Jansson leg.; NHRS - HEVA 000023107 ( NHRS) . • 1 ♀; Öland, Ekerums strand , dry meadow with mixed trees; 31 Jul. 1977; Sven Johansson leg.; NHRS - HEVA 000023115 ( NHRS) . • 1 ♂; Östergötland, S: t Anna, Svensmarö, Sanningsholmen ; 11 Aug. 1976; Gustav Wängsjö leg.; NHRS - HEVA 000023117 ( NHRS) . • 1 ♂; Östergötland, Tjärholm ; 5 Jul. 1976; Gustav Wängsjö leg.; NHRS - HEVA 000023116 ( NHRS) . • 1 ♂; Scania, Kristianstads kommun, Trunelän, Degeberga , Grazed meadow at alder stand along stream; 55.7746 ° N, 14.2156 ° E; ca 80 m a. s. l.; 16–26 Sep. 2018; Swedish Insect Inventory Programme ( SIIP), Station Linné leg.; Malaise trap; NHRS - HEVA 000023109 ( NHRS) . • 1 ♂; Scania, Kristianstads kommun, Trunelän, Degeberga , Grazed meadow at alder stand along stream; 55.7746 ° N, 14.2156 ° E; ca 80 m a. s. l.; 31 May- 9 Jun. 2019; Swedish Insect Inventory Programme ( SIIP), Station Linné leg.; Malaise trap; NHRS - HEVA 000023108 ( NHRS) . • 1 ♂; Scania, Kvistofta ; 1 Aug. 1949; Anton Jansson leg.; NHRS - HEVA 000023110 ( NHRS) . • 1 ♀; Småland, Bäckebo, Grytsjön , moist haymaking meadow at birch-spruce forest edge; 56.9314 ° N, 16.0855 ° E; ca 80 m a. s. l.; 12 Jul. - 18 Aug. 2005; Swedish Malaise Trap Project (Swedish Museum of Natural History) leg.; NHRS - HEVA 000023113 ( NHRS) . • 2 ♀♀; Småland ; [19 th cent.]; Carl Henning Boheman leg.; NHRS - HEVA 000023111 ( NHRS), NHRS - HEVA 000023112 ( NHRS) . • 1 ♀; Södermanland, Åva ; 20 Sep. 1953; Tor-Erik Leiler leg.; NHRS - HEVA 000023114 ( NHRS) .

Switzerland • 1 ♂; Neuchâtel, Auvernier ; 1 Aug. 1953; Jacques de Beaumont leg.; specimen at MHNG . • 1 ♂; same collection data as for preceding 10 Aug. 1957; specimen at MHNG . • 1 ♀; same collection data as for preceding 15 Aug. 1956; specimen at MHNG . • 1 ♀; same collection data as for preceding 25 Aug. 1966; specimen at MHNG . • 1 ♂; Neuchâtel, La Tourne ; 26 Aug. 1960; Jacques de Beaumont leg.; specimen at MHNG . • 1 ♂; Neuchâtel, Montmollin ; 14 Aug. 1957; Jacques de Beaumont leg.; specimen at MHNG . • 1 ♀; Valais, Mayens de Sion Aug. 1957; Jean-Louis Nicod leg.; specimen at MHNG . • 1 ♀; Vaud, Jorat ; 29 Jun. 1960; Jacques de Beaumont leg.; specimen at MHNG . • 1 ♀; Vaud, Vidy ; 28 Sep. 1953; Jacques de Beaumont leg.; specimen at MHNG .

Biology.

Summer species, flying mainly from July to September, peak in July. No clear habitat preference but in Sweden and Denmark often collected in open sandy pine forest.

Distribution.

Verified by morphological examination: Belgium, Denmark, Germany (locus typicus of A. aquisgranensis : Aachen and Megapelmus rufiventris Hartig, 1841 ), Sweden (locus typicus of A. staegeri ), Switzerland, United Kingdom (locus typicus of A. immunis : near London).

No DNA barcode matches with publicly available sequences from other countries.

Mainly collected in lowlands below 400 m a. s. l., occasionally found in higher altitudes at 700–900 m a. s. l. and rarely even higher.

Remarks.

Anacharis aquisgranensis was described by Förster (1869) because of its holotype having the mesoscutum fused with the mesoscutellum. He even erected the monotypic genus Synapsis (later replaced by Prosynapsis Dalla Torre & Kieffer, 1910 , due to homonymy) based on that state. Kierych (1984) considered the fusion as an aberrant state and synonymised Prosynapsis under Anacharis and A. aquisgranensis under A. immunis . We have not seen such a character state, but it seems rather aberrant if real, and we see no reason to question Kierych’s judgment until further.

The distribution records of A. immunis reported by Mata-Casanova et al. (2018) require re-evaluation as A. immunis sensu Mata-Casanova et al. (2018) also includes A. ensifer (see remarks there).

Figures

Figure 2. Fore and hind wings of different species of Anacharis showing the WIPs A A. ensifer stat. rev. male (ZFMK - TIS- 2629206) B A. immunis male (ZFMK - TIS- 2629539) C A. martinae sp. nov. female holotype (ZFMK - TIS- 2640787) D A. typica stat. rev. female (ZFMK - TIS- 2640857) E A. maxima sp. nov. male paratype (ZFMK - TIS- 2640676) F A. petiolata stat. rev. female (ZFMK - TIS- 2629285) G A. eucharioides male (ZFMK - TIS- 2629201).

Figure 3. Comparison of Anacharis male genitalia in ventral view A A. ensifer stat. rev. (ZFMK - TIS- 2629209) B A. immunis (ZFMK - TIS- 2629539) C A. martinae sp. nov. male paratype (ZFMK - TIS- 2640733) D A. typica stat. rev. (ZFMK - TIS- 2640757) E A. maxima sp. nov., male paratype (ZFMK - TIS- 2640741) F A. eucharioides (ZFMK - TIS- 2629243) A, B, F were dissected prior to DNA lysis C, D, E after lysis.

Figure 11. Anacharis immunis, female (ZFMK - TIS- 2640709) A habitus B mesosoma lateral C face D mesosoma dorsal E mesosoma posterior view.