Tammsaarea vivikae Tedersoo, 2024

Tedersoo, Leho, Magurno, Franco, Alkahtani, Saad & Mikryukov, Vladimir, 2024, Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes), MycoKeys 107, pp. 249-271 : 249-271

Tammsaarea vivikae Tedersoo sp. nov.

Diagnosis.

Separation from other species of Tammsaarea and other species of Endogonomycetes based on ITS (positions 228–257 ggaccgagaaggcgcaatagttgaacaatt; one mismatch allowed) and LSU (positions 585–604 ataactatcggacaaagttt; one mismatch allowed) as indicated in Fig. 16 .

Type.

eDNA sample TUE 100731 (holotype); eDNA sequence EUK 1602762 (lectotype); GSMc plot G 4189, Populus tremula forest (soil sample TUE 000731 ) in Tammsaare , Estonia, 57.84444 ° N, 27.20141 ° E .

Description.

Other sequences EUK 1604048 and EUK 1604049 (type locality).

Etymology.

Tammsaare (Estonian) refers to the type locality and one of the most famous Estonian writers, Anton Hansen Tammsaare; and Vivika (Estonian) refers to the first name of Vivika Adamson who provided access to the type locality.

Notes.

Found from a single locality in Estonia, with ITS and LSU sequences differing up to 0.5 % and 0.3 %, respectively.

Figures

Figure 16. Diagnostic barcodes for Tammsaarea vivikae relative to closely-related taxa in ITS 2 and LSU.