Eimeria detection

Jarquín-Díaz, Víctor Hugo, Balard, Alice, Jost, Jenny, Kraft, Julia, Dikmen, Mert Naci, Kvičerová, Jana & Heitlinger, Emanuel, 2019, Detection and quantification of house mouse Eimeria at the species level - Challenges and solutions for the assessment of coccidia in wildlife, International Journal for Parasitology: Parasites and Wildlife 10, pp. 29-40 : 31

2.5. Eimeria detection in tissue by qPCR

For mice collected in 2016 (n = 163) cecum and ileum tissue was screened using qPCR. Primers targeting a short fragment of mt COI were used to amplify DNA from intracellular stages of Eimeria (Eim_COI_qX-F, TGTCTATTCACTTGGGCTATTGT; Eim_COI_qX-R GGA TCACCGTTAAATGAGGCA). Amplification reactions with a final volume of 20 μL contained 1X iTaqTM Universal SYBR ª Green Supermix (Bio-Rad Laboratories GmbH, München, Germany), 400 nM of each primer and 50 ng of DNA template. Cycling in a Mastercycler ª RealPlex 2 (Eppendorf, Hamburg, Germany) was performed with the following program: 95 ̊C initial denaturation for 2 min, followed by 40 cycles of denaturation at 95 ̊C for 15 s, annealing at 55 ̊C for 15 s and extension 68 ̊C for 20 s. Melting curves were analysed to detect eventual primer dimer formation or non-specific amplification. As internal reference for relative quantification the CDC42 gene from the nuclear genome of the house mouse was amplified (Ms_gDNA_CDC42_F CTCTCCTCCCCTCTG TCTTG; Ms_gDNA_CDC42_R TCCTTTTGGGTTGAGTTTCC). Infection intensity was estimated as the ΔCt between mouse and Eimeria amplification (CtMouse- Ct Eimeria ). To correct for background noise a detection threshold was estimated at ΔCt = −5 and only results above this value were considered infected. ΔCtIleum and ΔCtCecum were compared for samples above the threshold in both tissues to assess primary tissue occurrence ( Ahmed et al., 2019). In samples positive for qPCR, Eimeria genotyping was performed based on DNA extracted from tissue, as described above (see 2.4).

2.6. Molecular identification of Eimeria spp . isolates : 18S and COI phylogenetic analysis

As strategy for molecular identification, datasets of nu 18S and mt COI sequences were compiled. Sequences generated for the present work were compared to databases sequences using NCBI BLAST and most similar sequences were selected. Based on this, sequences for E. falciformis , E. vermiformis and E. ferrisi were downloaded from GenBank as a reference. COI sequences were aligned by translation using the Multiple Align algorithm and translation frame 1 with the genetic code for “mold protozoan mitochondrial”, 18S sequences were aligned using MUSCLE ( Edgar, 2004), both through Geneious v6.1.8.

Phylogenetic trees for all datasets were constructed using Maximum Likelihood (ML) and Bayesian inference (BI) methods, implemented in PhyML v3.0 ( Guindon et al., 2010) and MrBayes v3.2.6 ( Huelsenbeck and Ronquist, 2001; Ronquist et al., 2012), respectively. The most appropriate evolutive models for each datasets were determined in JModelTest v2.1.10 ( Posada, 2008). For ML trees, a bootstrap analysis with 1000 replicates was performed, whereas MCMC for BI was run with two cold and two hot chains for 1,000,000 generations or until the average split frequency was below 0.05. The concatenated dataset was analysed using partitions and locus-specific models. Visualization of the trees was done with FigTree v1.4.2 ( Rambaut, 2012).