Cypretta campechensis, Cohuo-Durán, Sergio, Elías-Gutiérrez, Manuel & Karanovic, Ivana, 2013
|
publication ID |
https://doi.org/ 10.11646/zootaxa.3636.4.1 |
|
publication LSID |
lsid:zoobank.org:pub:42F90394-F287-4AD5-A383-7FFB6BDAA436 |
|
DOI |
https://doi.org/10.5281/zenodo.5668869 |
|
persistent identifier |
https://treatment.plazi.org/id/6C506414-1350-5614-FF33-682035234682 |
|
treatment provided by |
Plazi |
|
scientific name |
Cypretta campechensis |
| status |
sp. nov. |
Cypretta campechensis n. sp.
Figs 1–4 View FIGURE 1 View FIGURE 2 View FIGURE 3 View FIGURE 4 , 11 A–D View FIGURE 11. A – D .
Material examined. Holotype: female dissected on one slide (ECO-CH-Z-07516) from Yucatan peninsula, Silvituc Lake (N18.64054, E-90.29552). Collected by Manuel Elías-Gutiérrez, February 28, 2005. Allotype: Male dissected on one slide (ECO-CH-Z-07518) from same locality. Paratypes: 17 specimens from same locality, two females dissected on separate slides (ECO-CH-Z-07517, ECO-CH-Z-06235); thirteen females and two males preserved in 70% ethanol (ECO-CH-Z-07531).
Other material. One female from San José lake (18.36886, –8901259), dissected on one slide (ECO-CH-Z- 07527); three females from Tenancingo lake (N17.913694, E-90.545833), one dissected on a slide (ECO-CH-Z- 07528) and two preserved in 70% ethanol (ECO-CH-Z-07533); two females from Esmeralda lake (N18.351694, E- 92.090861), one of them dissected on one slide (ECO-CH-Z-07526) and one preserved in 70% ethanol (ECO-CH- Z-07534), six females from Charco hacia El Tigre (18.03957,–90.87065) one of them dissected on one slide (ECO- CH-Z-07524) and five preserved in 70% ethanol (ECO-CH-Z-07532); Laguna Las Golondrinas (N17.88975, E- 90.818639), one female dissected on one slide (ECO-CH-Z-07525).
Etymology. This species is named after Campeche State in Mexico, where it was found.
Diagnosis. Relatively big animals, with the surface of carapace smooth and covered by short and sparsely setae, except at the dorsal region. Both, anterior and posterior calcified inner lamella narrow. Funnel-shaped radial pore canals present below anterior margin on both valves. Females on postero-ventral side of calcified inner lamella of LV with a row of thin setae, RV on same region with nodes (see Sohn & Kornicker 1973). In males, thin setae present on RV, and nodes on LV. Flange well developed only ventrally. T2 with e-seta short and f-seta long and strong. Hemipenis with anvil-like inner lobe and medial lobe without spine-like process. On UR, Anterior claw distally curved and shorter than ramus, Posterior claw short, reaching just half length of anterior claw, anterior seta reaching 1/6 length of anterior claw; posterior seta less than half of posterior claw.
Description of the female. Carapace compressed, broadly arched in lateral view, greatest height around middle, or slightly to posterior half of valves ( Figs. 1 View FIGURE 1 A, B; 11B). Surface of valves smooth, with short and sparsely distributed setae. Valves slightly asymmetrical, LV overlapping RV on ventral, anterior and posterior ends ( Fig. 1 View FIGURE 1 C, D). Length of LV ( Fig. 1 View FIGURE 1 B) equalling 0.751–0. 860 mm, height 0.618–0.678 mm. Dorsal margin convex, with no marginal setae present. Ventral margin slightly concave around middle, with flange overlapping it. Anterior and posterior margins rounded, posterior one slightly wider than anterior one. Anterior margin internally with 15–17 uniformly distributed funnel-shaped radial pore canals (reduced septa). Calcified inner lamella covering 3.67–4.76% on anterior end and 7.83–8.73 % on posterior end ( Fig. 1 View FIGURE 1 E). On postero-ventral calcified inner lamella 15 nodes present ( Figs. 1 View FIGURE 1 E, 11D). Length of RV ( Fig. 1 View FIGURE 1 A) 0.727–0.830 mm with dorsal and ventral posterior margins similar to LV. Anterior margin with 17–19 funnel-shaped radial pore canals and abundant marginal setae. Calcified inner lamella covering 6.28–7.14 % of the valve on posterior end, and 2.87–3.17 % on anterior end ( Fig. 1 View FIGURE 1 F). Medially, on postero-ventral inner calcified lamella, a row of thin and short setulae present ( Fig. 1 View FIGURE 1 F). Muscular imprints on valve consist of five large adductor scars and two elongated mandibular scars ( Fig. 11C View FIGURE 11. A – D ).
A1 ( Fig. 2 View FIGURE 2 A). 7-segmented. First segment (CB) with three setae; CB2 exceeding distal end of following segment and setae Ex1 and Ex2 long and pappose, Ex2 just exceeding distal end of fifth segment and Ex1 with 9/ 10 the length of Ex2. Seta CB1 missing. Second segment (En1) with seta En1a, reaching 1/3 of following segment and Rome organ present. Third segment (En2) with En2a exceeding distal end of fifth segment and En2c, reaching distal end of fourth segment. Fourth segment (En3) posteriorly with En3c and En3d equally long, reaching distal end of penultimate segment. Anteriorly, seta En3a smooth, while En3b sparsely covered with short setulae. Fifth segment (En4) with four setae, the posterior En4d pappose, extended beyond terminal segment. En4c smooth, just exceeding distal end of terminal segment. Anterior setae En4a and En4b long and pappose. Sixth segment (En5) with En5a, En5b and En5c, long and pappose. En5d smooth, 17.1 times as long as terminal segment. Terminal segment (En6) with four setae, En6a and En6b long and pappose, En6c short and smooth, 3.7 times longer than segment, aesthetasc y a 5.3 times length of terminal segment. Length ratios of terminal five segments 2.8: 1.6: 1.1: 0.9: 1.
A2 ( Fig. 2 View FIGURE 2 B). 5-segmented. Basal segment with two equally long, pappose setae. Second segment with one long and pappose seta, exceeding distal end of terminal segment. Exopodite (Ex) with two short and one long setae. First endopodal segment (En1) with six swimming setae, five of them feathered and extending slightly beyond tips of terminal claws, while sixth one smooth and shorter, reaching distal end of penultimate segment. Anterior end of this segment carrying one pappose seta, extending beyond terminal segment and one aesthetasc Y antero-medially. Second endopodal segment (En2) with two unequal and smooth posterior setae and four anterior setae: longer ones similar in length (approximately 8.4 times length of terminal segment), and shorter ones slightly more than halflength of two longer setae. Distal end of same segment with two z-seta (z2 and z3) and three terminal claws, G1, G2, G3 subequally long, (10.4 times length of terminal segment) with spine-like tips. Terminal segment (En3) bearing one short smooth seta, and one aesthetasc (y3) along with two claws GM and Gm, the latter approximately 4/5 length of GM. Length ratio of endopodal segments 7.4: 4.6: 1.
Md ( Fig. 2 View FIGURE 2 C, D) mandibular coxa armed with seven teeth, and three tooth-like setae between them. Anteriormost tooth more strongly developed than other ones. Basis of posterior-most tooth with three setulae and two pappose setae. One strong and pappose seta situated more proximally on coxa and approximately 1.5 length of anterior-most tooth.
Mdp ( Fig. 2 View FIGURE 2 D). 4-segmented. First segment with pappose α-seta, not reaching end of following segment. Second segment with setal group consisting of three long and pappose setae. β seta strong and pappose, reaching distal end of segment. Posteriorly three unequally long setae. Penultimate segment with nine setae distributed on anterior and posterior ends, posterior ones subequally long: one of these setae swollen and modified into claw, and representing γ-seta. Terminal segment with two claw-like setae and two setae. Former ones subequally long (both with spine-like tip), with 4.4 times length of terminal segment.
Mx1p ( Fig. 2 View FIGURE 2 E). Two-segmented. First segment with 7 setae, two distinctively stronger and longer than rest. Second segment cylindrical, approximately 1/3 length of first segment. On distal end, second segment bearing five claw-like setae, four of them subequally long, 2.2 times length of last segment, while fifth one 2/3 length of longer ones. Teeth on third masticatory process smooth.
Rake–like organ ( Fig. 3 View FIGURE 3 A) T-shaped with seven and eight teeth on left and right sides respectively.
T1 ( Fig. 3 View FIGURE 3 B) with protopodite armed with ten pappose terminal setae, and three subterminal pappose setae; b–seta present, exceeding distal end of protopodite.
T2 ( Fig. 3 View FIGURE 3 C). 5-segmented. Protopodite bearing long and pappose d1 and d2 setae. First endopodal segment with e–seta pappose, not reaching distal end of third endopodal segment. Second endopodal segment with f-seta pappose, extending beyond terminal segment. g-seta on third endopodal segment slightly exceeding distal end of terminal segment. Fourth endopodal segment short, with terminal claw, long and strong, distally serrated, twice as long as terminal three segments combined. Setae h1 pappose and h3 smooth.
T3 ( Fig. 3 View FIGURE 3 D). 4-segmented. Protopodite with d1, d2 and dp long and pappose setae. First endopodal segment with e–seta subapical, short and pappose. Second endopodal segment with f-seta short on medio-lateral side. Terminal segment reduced to a pincer-like organ, with short and strong, distally serrated h2 seta, h1 claw-like and short, and h3 long and plumose on dorsal side.
UR ( Fig. 3 View FIGURE 3 E) long and thin, anterior margin smooth, 1.3 times longer than anterior claw. Anterior claw thin and distally serrated. Anterior seta short, 1/6 length of anterior claw. Posterior claw thin and distally serrated, not reaching half length of anterior claw. Posterior seta less than half length of posterior claw. Attachment of UR ( Fig. 3 View FIGURE 3 F) long and narrow, distally bifurcated.
Male. LV ( Fig. 4 View FIGURE 4 B). Length 0.680–0.718 mm, height 0.630 mm. On anterior margin 15–17 funnel-shaped radial pore canals distributed along internal margin. Anterior inner calcified lamella covering 3.6–3.9 % and posterior one 2.8–3.1 %. On postero-ventral side of calcified inner lamella row of radiating, thin and short setulae present ( Fig. 4 View FIGURE 4 B).
RV ( Fig. 4 View FIGURE 4 A). Length 0.660–0.705 mm, heigth 0.626 mm. Similar to female. Anterior end with 16 funnelshaped radial pore canals along internal margin ( Fig. 4 View FIGURE 4 A). Postero-ventral side of inner calcified lamella with 12 nodes ( Fig. 4 View FIGURE 4 A).
A1 ( Fig. 4 View FIGURE 4 C) without sexual dimorphism, length ratios of five distal segments 3: 1.9: 1.1: 1.07: 1.
A2 ( Fig. 4 View FIGURE 4 F) sexually dimorphic, second endopodal segment (En2) anteriorly with only two setae (t-setae), one smooth and long, other pappose and 2/3 the length of previous seta. Three z-setae present. On the same segment, G1 reduced reaching just 2/3 the length of adjacent claws (G2 and G3). On terminal segment GM present and Gm modified into a seta. Length ratios of the endopodal segments 7.8: 4.3: 1.
T1 ( Fig. 4 View FIGURE 4 D, E), protopodite bearing 8 pappose terminal setae and two subterminal setae. One a-seta and one bseta present. Prehensile palps two-segmented and asymmetrical. Right palp ( Fig. 4 View FIGURE 4 D) stout, with first segment cylindrical. On distal margin a couple of little outgrowths forming a small projection. Finger curved and wide. First segment of left palp ( Fig. 4 View FIGURE 4 E) with small projection at distal end. Finger narrow and curved.
Hemipenis ( Fig. 4 View FIGURE 4 G) with two conspicuous terminal lobes, internal one anvil-like. A small lobule between them, without spine-like process. Internal canal double coiled.
Additional character. Cypretta campechensis n. sp. was the only species that rendered good sequences of the COI gene. Here we include a representative sequence as one additional character for future comparisons: AACTCTTTATCTTATTTTCGGGGCTTGATCAGCAATACTAGGAACGGCTCTTAGAGTAATTATTCGTGCT GAATTAGGCCAACCAGGTTCTTTAATTGGTAATGATCAGATTTATAATACAATCGTTACTGCCCATGCAT TCATTATGATTTTCTTTATAGTAATGCCTATTATAATTGGAGGGTTTGGAAATTGATTAGTTCCGCTTATA CTAGGGGCACCAGATATAGCATTCCCTCGAATGAATAATATAAGGTTTTGACTATTACCCCCTTCTCTTT CTCTTTTAACAATTGGTCTATTAACAGAAAGTGGAGCAGGAACAGGATGAACAGTATACCCTCCACTT TCCGGGAACATCGCTCATTCAGGATCTAGAGTAGATTTAACAATTTTTTCTCTTCATTTAGCTGGGGCAT CTTCAATTTTAGGCGCAATTAACTTTATTACAACGATTATTAATATACGAGCCGCAAGAATATCCCTAGA TCGAATTCCCCTTTTCGTTTGATCAGTAGGAATTACTGCTTTACTACTTCTCTTATCCCTTCCAGTCCTT GCAGGAGCGATCACAATACTACTTACTGATCGAAACTTAAACACAACCTTCTTTGACCCTGCCGGTGG TGGAGATCCAATTTTATACCAACATTTATTT
Distribution. Recorded in Laguna Silvituc, Laguna Esmeralda, Charco hacia el Tigre, Laguna San José, Laguna Tenancingo, Laguna Las Golondrinas, and Laguna Pedro Baranda, freshwater systems located on the southwestern portion of the Yucatan Peninsula ( Fig. 13 View FIGURE 13 ).
Remarks and affinities. Cypretta campechensis n. sp. belongs to the group of species in which the LV overlaps the RV. Currently, there are five other species with the same character: C. reticulata Lowndes, 1932 ; C.
schubarti Farkas, 1959 ; C. nigra Furtos, 1936 ; C. brevisaepta Furtos, 1934 and C. bilicis Furtos, 1936 . The last three species were described from Florida and North Carolina (Furtos 1934, 1936). Cypretta campechensis n. sp. and the three North American species are closely related, sharing some characteristics such as a short posterior seta on the UR, and the posterior claw half (or less) the length of the anterior claw. These features clearly distinguish them from C. schubarti and C. reticulata , because the former has the posterior seta on the UR as long as the posterior claw and the latter ones have the posterior claw on the UR longer than 1/2 length of the anterior one. The main distinguishing feature between C. campechensis n. sp. and C. brevisaepta is the shape of the inner and medial lobe on the hemipenis. In the Mexican species, the inner lobe is anvil-like, and the medial lobe smooth, while in C. brevisaepta the inner lobe is oval and the medial lobe is armed with a spine-like process. The new species also has a well-developed flange, overlapping the ventral margin of both valves. The Mexican species differs from C. nigra by the length of the f-seta on T2: in C. nigra this seta slightly exceeds the distal margin of the terminal segment; in C. campechensis n. sp. the f–seta is much longer, by far exceeding distal end of the segment. The two species also differ in the length of the terminal segment of the Mx1p: in C. campechensis n. sp. it is two times longer than wide, in C. nigra it is three times longer than wide. Cypretta campechensis n. sp. and C. bilicis differ mainly in the length of UR setae, which are shorter in the Mexican species, and in the shape of inner lobe of the hemipenis, which is narrow and rounded in C. bilicis .
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.