Plesiochrysa ramburi ( Schneider, 1851 ) New

Wang, Maozhi, Li, Ziyuan & Liu, Xingyue, 2023, A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance, Zootaxa 5360 (4), pp. 568-582 : 575-581

Plesiochrysa ramburi ( Schneider, 1851) New record to China

( Figs 5–7 )

Chrysopa ramburi Schneider, 1851: 107 . Type locality: Australia (no further locality data).

Chrysopa jaluitana Kempny in Schnee, 1904: 403. Type locality: Australia (Jaluit, Marshall islands).

Chrysopa vicina Kempny, 1904: 354 . Type locality: Australia (no further locality data).

Chrysopa neutra Navás, 1910: 47 . Type locality: Australia (no further locality data).

Chrysopa deutera Navás, 1914: 106 . Type locality: Australia ( Cocos-keeling islands ).

Chrysopa notosticta Navás, 1914: 104 . Type locality: Australia (Sydney).

Chrysopa reaumuri Navás, 1914a: 646 . Type locality: Australia (Condolin).

Chrysopa controversa Lacroix, 1920: 104 . Type locality: Tonga (Vava’u islands).

Diagnosis. Body medium-sized. Head with a pair of black stripes on frons, two pairs of black stripes on vertex, and two pairs of black stripes on scape. Thorax with three pairs of black markings. Abdomen with a pair of black spots and a pair of black stripes. Wing veins mostly pale with gradates and some longitudinal veins brown basally.

Description. Adult. Body mostly pale green, 9.5–10.9 mm long ( Fig. 5A, E ).

Head. 1.6–1.9 mm wide (including compound eyes). Mostly greenish, with a pair of black transverse stripes on frons, a pair of black stripes present around antennal socket, and two long black stripes on occiput. Mandibles asymmetrical, broad. Antenna with scape greenish, marked with black stripes laterally and dorsally, less than 1.5x wide; pedicel brownish, with a black marking laterally; flagellum brownish, gradually darkened distad; flagellar setal arranged in four rings. Labial and maxillary palpi unmarked, yellowish, but brownish and slightly flattened apically ( Fig. 5B, C, D ).

Thorax. Pronotum about 1.2 times as long as wide, laterally with two pairs of small black markings, medially with a pair of black transverse stripes and a pair of reddish cloudy bands; setae dark; transverse sulci present. Meso- and metanotum unmarked, or sometimes with a pair of black spots on metanotum ( Fig. 5A, B, C, E ).

Legs. Greenish, unmarked, covered with short black setae; claws curved, brown.

Forewing. 12.2–14.1 mm long. Wing membrane transparent, rounded apically, tegula unmarked; veins mostly greenish, but 4–5 costal crossveins (c-sc) black at base; 6–11 c-sc, subcostal crossvein (sc-r), 1–2 radial crossveins (r-rs), crossvein between pseudocubitus and pseudomedia (psc-psm), CuA, CuP, A1, and A2 marked black. Costa area narrow basally, c-sc simple, straight, 17 costal crossveins present; basal crossvein between subcostal and radius present, crossveins posterior pterostigma absent; 8 radial crossviens, intramedian (im) cell triangular, subdistally connected by 1 rp-m crossvein to R; two gradate series of crossveins present, number of gradates (inner/outer): 3/6; gradate series not parallel, basal crossveins of first gradate series meeting PsM; distal cubital cell (dcc) open, CuP not forked ( Fig. 5A ).

Hind wing. 11.2–12.6 mm long. Pterostigma yellowish; veins greenish; 15 costal crossveins present; basal subcostal marked brown; six crossveins between PsC and PsM; two gradate series of crossveins, number of gradates (inner/outer): 3/5 ( Fig. 5A ).

Abdomen. Greenish; tergite 1 marked with two pairs of black spots, tergites 2–5 respectively marked with a pair of black stripes and two pairs of black spots; ventral margin slightly tinged with brown; sternites greenish, sternites 1–5 covered with short pale setae, sternites 6–9 (or 6–7 in female) with short black setae; spiracles small, round, not enlarged, atria not enlarged ( Fig. 6A, B ).

Male genitalia. Dorsal abdomen regular; tergite 9 and ectoprocts fused; ectoproct rounded; dorsal invagination shallow; thick spines on ectoproct absent; sternites 8 and 9 fused, regular, without strong apical spines; gonarcus medially fused, gonarcal bridge with two projecting horns and two longer, slender ventral processes on each side, acutely pointed at tip; gonarcal apodeme simple, with entoprocessus long, bending inward; gonarcus complex; pesudopenis constituted by a pair of extraordinarily asymmetrical pieces, mediuncus process absent; numerous gonosetae present; microtholi present ( Fig. 6A, C, D, E, F, G, H ).

Female genitalia. Tergite 9 and ectoprocts fused; sternite 7 simple, apically rounded; small sclerotized plate between subgenitale and sternite 7 absent; subgenitale broader than long, attached on a broad membranous structure; spermatheca normal; vela smaller than spermatheca; spermathecal duct curved ( Fig. 6B, I, J ).

Semaphorom I ( Fig. 7C, D ).

Body. Small, compact, flat ventrally, dorsal surface not abruptly elevated. Integument smooth, without microtrichia, bearing four types of setae: (i) medium length, stout, with acute tip (primary cephalic setae); (ii) long, robust, slightly denticulate to smooth, curved basally, curved-to-bent distally, with acute apex (most setae on lateral and laterodorsal tubercles of thorax and abdomen; LS, LDS); (iii) long, slender, smooth, curved submedian setae (SMS) on dorsum of mesothorax, metathorax, and first to sixth abdominal segments; (iv) short to medium length, straight, smooth, with acute tip. SMS extremely tapered and thin distally, being difficult to determine whether tips of these setae are acute or minutely hooked.

Head. Dorsum smooth, well sclerotized; posterior margin quadrate, partially retracted into cervix; anterior region beneath base of antenna forming pedicellate extension. Six stemmata, all well separated, small. All primary cephalic setae (S1–S12) present, with acute tips. S11 robust, long, directed anteriorly; S1, S2, S3, S6, S12 medium length, thinner than S11; S5 relatively small; anterior region of head with two pairs of small, smooth, acute setae; anterior tip of clypeus with a pair of large, slightly denticulate, acute setae projecting anteriorly. Venter with cardo and stipes robust, elongate, and rectangular; primary setae (S8–S10) smooth, short to medium length; S8 posterior to eye; S9, S10 near each other, medial to eye. Ventral midregion with three pairs of setae on or near mentum.

Cephalic appendages. Clypeus large, extending laterally toward base of mandibles. Mandible short, stout, heavily sclerotized, with sharply acute tip. Maxilla broad basally, with two short basolateral setae; rounded, heavily sclerotized, with small patch of microsetae at tip. Labial palpus extending to or slightly exceeding tip of mandible; terminal segment rounded, tapering distally, terminus with small, pale, round projection bearing ventral pore and several microsetae apically. Basal palpomere with two pairs of long distal setae, one lateral, one mesal. Antennal pedicel elongate, tapering, with irregular annulations. Flagellum narrow, tapering distad, closely pressed against lateral margin of flagellum; terminus with two elongate terminal setae extending anteriorly, then curving toward each other, and with mesal seta usually longer than lateral one.

Cephalic coloration. Anterodorsal surface pale; integument around and between stemmata dark brown; pedicellate dark brown dorsally, pale ventrally. Venter with anterior margin, sclerites dark brown; intersegmental membrane pale. Antenna with pedicel brownish; pedicel pale, with base and annulations brownish; flagellum brownish to amber. Mandibles and maxillae brownish basally.

Thorax. Each segment with a pair of broad, thick, palmate, lateral tubercles (LTs); distal margin of each LT with robust chalazae bearing prominent setae (LS); LS long, robust, denticulate, dark brown at tip, with tip straight, unhooked; sclerites indistinct. Prothorax pale, smooth, well sclerotized on dorsal surface, with sparse setae, no microsetae; each LT with seven to eight LS; pronotal setae medium length, straight, with acute tips, arising from small chalazae. Meso- and metathorax dorsally with dense submedian setae (SMS) dark brown, no microsetae; LTs similar to those on prothorax, each bearing eight to ten long LS; laterodorsal tubercles (LDTs) absent; SMS arranged in two broad bands along anterior and posterior margins of each segment; SMS medium length, slender. Spiracular seta (SSp) not identified.

Leg. Brownish distally, pale basally; setae pale, with acute tips. Coxa elongate, with few setae; femur with sparse setae; tibia with numerous setae, separated from tarsus; claws slender, deeply cleft; empodium long, with elongate bristle beneath.

Abdomen. First segment (A1) short, narrow, without spiracle, LT, or LDT, with transverse band of dense SMS dorsally. Segments A2–A5 longer and broader than A1, bearing a pair of bulbous LTs, round spiracular opening near dorsomesal margin of LT, without laterodosal tubercles (LDTs). LTs brownish dorsally, with two denticulate LS, no microsetae; segment with transverse band of dense SMS dorsally. Segments A6–A7 each with a pair of laterodorsal tubercles (LDTs) near anteromesal margin of LT base. LDTs bearing two or three robust, denticulate, acute setae (LDS), one long, others short; segments without microsetae, posterior section without setae. Dorsum of A7 with a pair of setae (SSp) associated with spiracles, two pairs of anterior setae between spiracles, two pairs of longer, more robust setae between LTs, a pair of setae near posterior margin. Segment A8 well sclerotized dorsally; LT short, bulbous laterally, with robust, denticulate LS (one longer than others); with two pairs of robust setae in midsection between LTs, two pairs of short, smooth, acute, setae anterolaterally. Segment A9 tubular, heavily sclerotized posteriorly; anterior section with pair of very small setae; midsection with single pair of long, robust setae laterally. Segment A10 without setae except for single pair of smooth, acute setae near terminus.

Semaphorom III ( Fig. 7A, B, E, F, G ).

Body. Stocky, globose dorsally, flat ventrally; thoracic, abdominal nota wide, extending fully over sides of body, with LTs extending laterally from ventral margins of nota. Thorax and abdomen with dark transverse bands, separated by pale bands and intersegmental membrane. Four types of setae: (i) smooth, unhooked; (ii) stout, short, straight, with acute tip; (iii) stout, with blunt to acute tip; (iv) simple, small, straight, with acute tip ( Fig. 7G ).

Head. Nearly quadrate; anterior margin slightly convex; no noticeable markings; dorsal setae dark ( Fig. 7A, B, E, F ).

Head appendages. Mandible short, stout, with acute tip. Antenna short, robust, tapering; scape with stout setae on distolateral margin; pedicel annulated; flagellum tapered, apparently with elongate terminal setae Cervix dark, probably well sclerotized, at least on lateral portion ( Fig. 7A, B, E, F, G ).

Head coloration. Anterodorsal surface of head entirely dark brown, with brownish marking at median, and a pair of irregular broad band extending from margin of each eye to posterior, but not meet each other; integument around and between stemmata dark brown. Venter margin dark brown; intersegmental membrane pale. Antenna with scape, base of pedicel dark brown; pedicel dark brown; pedicel with annulations brownish basally; flagellum brownish to amber. Mandibles and maxillae brownish basally ( Fig. 7A, B, E, F, G ).

Thorax. Segments broad, dorsoventrally thickened, each with a pair of LTs; LTs robust, rounded distally, with distal margin bearing robust LS, with dorsal surface bearing sparse acute setae; prothorax with two subsegments, mesothorax with three subsegments, metathorax apparently with one. Legs stocky, brownish, but claws darker; tarsi particularly short ( Fig. 7 G ).

Abdomen. Segments A1–A6 broad, thick; together with thorax forming large, densely setose, dorsal arch of body; A1 with only one visible subsegment, without LTs, dorsally about as long and wide as metathoracic posterior subsegment, excluding LTs. Segments A2–A6 each with two subsegments dorsally, subsegments merging above LTs; LTs round, spherical distally, with short base, bearing robust, curved, or bent LS distally, smaller, hooked setae dorsally. Segments A7–A10 without distinct subsegment; each segment narrower than, and probably partially retractable within preceding segment; surfaces with sparse, short, acute setae. A7 with LTs about as long as those on A5 or A6, but much narrower, their apices with dense covering of robust, acute LS extending posteriorly; spiracles near anterior margin of segment. A8 with small lateral LTs bearing short, slender, acute setae; spiracles at base of segment. A9, A10 conical (LTs absent), with short slender, acute setae ( Fig. 7 G ).

Material examined. 6♁ 6♀, CHINA, Guangdong, Zhanjiang, sisal plantation of South Subtropical Crops Research Institute CATAS, 21°17′N, 110°29′E, VI.2019 , Ziyuan Li ( CAU) .

Larval specimens examined. First instar, 5 individuals; second instar, 6 individuals; third instar, 5 individuals. All larvae reared from the eggs laid by females collected from above collecting site in Guangdong ( CAU).

Distribution. Australia, China, Indonesia, Malaysia, New Guinea, Western Pacific Islands (widespread).

COI barcode sequence.

AATAATATAGTAATAGCCCCGGCTAATACTGGTAAAGAAAGAAGAAGAAGTAAAGCTGTAATTACT ACTGATCAAACAAATAATGGTATTCGATCTAATGTTATATAGCTTAATCGTATATTAATTACTGTAGT AATGAAATTTACTGCCCCTAAAATAGAAGAAATTCCGGCAAGGTGTAAACTAAAAATAGCTAAATC AACAGATGCCCCAGCATGAGCAATACTAGATGAAAGAGGAGGGTACACAGTTCAACCTGTCCCAGC ACCTCTTTCTACTATAGACGAAGCAAGTAATAATGTTAAGGAAGGAGGAAGTATTCAAAATCTTATA TTATTTATTCGAGGAAAAGCTATATCAGGGGCTGCTAATATTAGTGGAACTAATCAATTTCCAAACC CACCAATTACAATAGGTATTACTATGAAAAAAATTATAATAAAAGCATGAGCTGTAACAATTACAT TATAAATTTGATCATCTCCAATTAGAGATCCAGGTTGTCCTAATTCAGCTCGAATTAATAAACTTAA TCTAGTTCCAACTAATCCTGACCAAATTCCAAAAATAAAATAAAGGGTACCAATATCCTTATGATTT GTTGAAAATAACCATTGTCGCATCAAACA

Figures

FIGURE 5. Plesiochrysa ramburi (Schneider, 1851), male.A. habitus, dorsal view; B. head and prothorax, dorsal view; C. head and prothorax, lateral view; D. head, frontal view; E. head and thorax of fresh specimen, dorsal view. Abbreviations: A, anal veins; C, costa; CuA, cubitus anterior; CuP, cubitus posterior; MA, media anterior; MP, media posterior; PsC, pesudocubitus; PsM, pesudomedia; RA, radius anterior; RP, radius posterior; Sc, subcosta; ig, inner gradate; im, intramedian cell; mg, middle gradate; og, outer gradate.

FIGURE 6. Plesiochrysa ramburi (Schneider, 1851). A. male terminalia, lateral view; B. female terminalia, lateral view; C. male genitalia, lateral view; D. pesudopenis, lateral view; E. male genitalia, frontal view; F. gonarcus complex, lateral view; G. male genitalia, ventral view; H. gonarcus complex, frontal view; I. spermatheca, lateral view; J. subgenitale, ventral view. Abbreviations: cc, callus cerci; ent, entoprocessus; gl, gonapophysis lateralis; g.ap., gonarcal apodeme; gcn, gonocoronu; gst, gonosetae; lf, lateral flank of gonarcus; sd, spermathecal duct; sg, subgenitale; sp, spermatheca; S7, sternite 7; S8+9, sternites 8+9; T7 and T8, tergite 7 and 8; T9+e, tergite 9+ectoprocts.

FIGURE 7. Plesiochrysa ramburi (Schneider, 1851). A. third instar larva, dorsal view; B. third instar larva, ventral view; C. first instar larva, head and thorax, dorsal view; D. first instar larva, head and thorax, lateral view; E. third instar larva, head, dorsal view; F. third instar larva, head and thorax, lateral view; G. third instar larva, habitus, lateral view. Abbreviations: co, cardo; cx, cervix; gen, gena; int, intermandibular marking; l.p., labial palpus; mb, mandible; mx, maxilla; ped, pedicel; pg, palpiger; sc, scape; stp, stipes; S1–S12, primary cranial setae 1–12; LS, setae on lateral tubercle; LT, lateral tubercle; SMS, submedian setae.