Apertochrysa roseusfrontata, Wang & Li & Liu, 2023

Wang, Maozhi, Li, Ziyuan & Liu, Xingyue, 2023, A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance, Zootaxa 5360 (4), pp. 568-582 : 570-575

Apertochrysa roseusfrontata sp. nov.

( Figs 2–4 )

Diagnosis. Body small-sized, greenish. Head with reddish markings on frons and scape, without dark spots on gena. Thorax with reddish markings. Abdomen reddish ventrally. Wing veins mostly pale, with gradates brown. Male genitalia without tignum.

Description. Adult. Body mostly pale green, 8.1–9.5 mm long ( Fig. 2A ).

Head. 1.1–1.7 mm wide (including compound eyes). Yellowish, with genal marking absent; frons reddish entirely, reddish spots present on intra-antennal frons. Mandibles asymmetrical, broad; labial and maxillary palpi yellowish, brownish on base of palpomeres 2–3, brownish and slightly tapered apically. Antenna longer than forewing, brownish, but pale at base; scape with reddish stripes laterally, pedicel unmarked, flagellar setael arranged as four rings, flagellum yellowish, setae brownish ( Fig. 2B, C, D, E ).

Thorax. Greenish, pronotum about 1.2 times as longer as wide; setae pale, with three pairs of brownish markings respectively near anterior angels, middle and posterior margin; a yellowish longitudinal median stripe with reddish line, present on pro-, meso- and metanotum ( Fig. 2B, C, D ).

Legs. Greenish yellow, unmarked, covered with brown setae; claws curved, brown.

Forewing. 10.0– 13.3 mm long. Rounded apically; tegula unmarked; veins mostly greenish, but gradate crossveins, last crossvein between PsM and PsC, and 1st crossvein between PsC and CuP marked brown; setae long, dark, relatively short basally; costal area narrowly at base, costal crossveins simple, 16 costal crossveins present, slightly sinuous on fourth and fifth crossveins; pterostigma greenish; Sc and RA not fused, basal subcostal crossvein present, three distal sc-r crossveins posterior pterostigma; 11 radial crossveins present, intramedian cell triangular, subdistally connected by a rp-m crossvein to R; two gradate series of crossveins present, number of gradates (inner/ outer): 5/5; gradate series not absolutely parallel, basal crossveins of first gradate series not meeting PsM; dcc open, CuP not forked ( Fig. 2A, F ).

Hind wing. 9.2–11.2 mm long. Pterostigma greenish, veins pale; 16 costal crossveins present; four distal sc-r crossveins posterior pterostigma; six crossveins between PsC and PsM present; two gradate series of crossveins present, number of gradates (inner/outer): 3/6 ( Fig. 2A ).

Abdomen. Greenish; yellowish longitudinal median stripe with reddish margin on tergum; sterna reddish; setae pale ( Fig. 2A ).

Male genitalia. Tergite 9 and ectoprocts fused, ectoproct rounded; ventral apodeme regular; sternites 8 and 9 fused, regular, without dense setae. Tignum absent; gonarcus medially fused, with long ovate lateral pieces; entoprocessus large, ventrally curved apex, positioned at joint of medial arch and lateral arms; mediuncus closely associated with gonarcus, with membranous connection; gonapsis present, small, with short bilobed apex and narrow side-pieces; hypandrium internum triangular, V-shaped in lateral view, with a thin rod medially; gonosetae sparsely present; microtholi absent ( Fig. 3A, C, D, E, F ).

Female genitalia. Tergite 9 and ectoprocts fused; sternite 7 simple, apically rounded; praegenitale absent; small sclerotized plate between subgenitale and sternum 7 absent; subgenitale as long as broad; spermatheca surface smooth; vela smaller than spermatheca; spermathecal duct curved ( Fig. 3B, G, H ).

Semaphorom I ( Fig. 4C, D ).

Body. Small, compact, dorsal surface not abruptly elevated. Integument smooth, without microtrichia, bearing four types of setae: (i) long to medium length, stout, slightly denticulate, with acute tip (primary cephalic setae); (ii) long, robust, denticulate and straight basally, curved distally, with acute apex (most setae on lateral and laterodorsal tubercles of thorax and abdomen; LS, LDS); (iii) long, slender, smooth, curved setae (SMS), tapered and thin distally on dorsum of mesothorax, metathorax, and first to sixth abdominal segments; (iv) long, curved, smooth, with acute tip (some primary setae on head, pronotum, seventh and eighth abdominal segments).

Head. Dorsum smooth, well sclerotized; posterior margin quadrate, partially retracted into cervix; anterior region beneath base of antenna forming pedicellate extension. Six stemmata, all well separated, relatively small. All primary cephalic setae (S1–S12) present, with acute tips. S1 and S11 robust, long, directed anteriorly; S2, S3, S5, S6, S12 medium length, robust, but slightly slender than S1 and S11; anterior region of head with two pairs of small, smooth, acute setae; anterior tip of clypeus with pair of large, slightly denticulate, acute setae projecting anteriorly. Venter with cardo and stipes robust, elongate, and rectangular; primary setae (S8–S10) smooth, short to medium length; S8 posterior to eye; S9, S10 near each other, medial to eye. Ventral midregion with pairs of setae.

Head appendages. Clypeus large, extending laterally toward base of mandibles. Mandible long, slender, heavily sclerotized; with sharply acute tip. Maxilla broad basally, with basolateral setae; round distally, heavily sclerotized, with small patch of microsetae. Labial palpus with terminal segment slender, tapering distally, terminus with small, pale, round projection, bearing ventral pore and several microsetae apically. Basal palpus segment with two pairs of long distal setae. Antennal scape set within pedicel elongate, tapering, with irregular annulations. Flagellum round in cross section, narrow, tapering to flagellum; terminus with two elongate, terminal setae curving toward each other, with mesal seta usually longer than lateral one.

Cephalic coloration. Anterodorsal surface of head pale, with a pair of brownish bands anteriorly, and two pairs of brownish spots; integument around and between stemmata brownish. Venter margin sclerites brownish; intersegmental membrane pale. Antenna with scape brownish; pedicel pale, with base and annulations brownish; flagellum brownish to amber. Mandible and maxilla brownish basally.

Thorax. Each segment with pair of broad, thick, palmate, lateral tubercles (LTs); distal margin of each LT with robust chalazae bearing prominent setae (LS); LS long, robust, with tip brownish, curved. Prothorax pale, with a pair of brownish spots, surface smooth, well sclerotized, with sparse setae, no microsetae; each LT with three or four LS; pronotal setae medium length, straight, with acute tips. Dorsal mesothorax with a pair of brownish spots, meso- and metathorax with dense submedian setae (SMS) dark brown, no microsetae; LTs similar to those on prothorax, each bearing three or four long LS; laterodorsal tubercles (LDTs) absent; SMS arranged in two broad bands across surface of each segment; SMS medium length, slender.

Leg. Dark brown distally, pale basally; setae pale, with acute tips. Coxa with few setae; femur and tibia with numerous setae; claws slender, deeply cleft; empodium long.

Abdomen. First segment (A1) short, narrow, without spiracle, LT, or LDT; with transverse band of dense SMS dorsally. Segments A2–A5 longer and broader than A1, bearing a pair of bulbous LTs, round spiracular opening near dorsomesal margin of LT, without laterodosal tubercles (LDTs). LTs brownish dorsally, with two denticulate LS, no microsetae; segment with dense SMS. Segments A6–A7 each with a pair of laterodorsal tubercles (LDTs). LDTs bearing two robust, long, acute setae (LDS), curved, brownish at tips; segments without microsetae, posterior section without setae. Segment A8 with short, bulbous LT laterally, with robust, denticulate LS. Anterior section of segments A9 and A10 with pair of very small setae dorsally, and midsection with a pair of short, robust setae laterally. Segment A10 without setae except for single pair of smooth, acute setae near terminus.

Semaphorom III

( Fig. 4A, B, E, F, G ). Body. Stocky, globose dorsally, flat ventrally; thoracic, abdominal notum wide, extending fully over sides of body. Thorax and abdomen with dark transverse bands, separated by pale bands and intersegmental membrane. Four types of setae: (i) smooth, unhooked; (ii) stout, short, straight, with acute tip; (iii) stout, with blunt to acute tip; (iv) simple, small, straight, with acute tip ( Fig. 4A, B, E, F, G ).

Head. Subquadrate; anterior margin slightly convex, dorsal setae dark.

Head appendages. Mandibles long, slender, with acute tip. Antenna long, slender, tapering; scape with stout setae on distolateral margin; pedicel annulated; flagellum tapered, apparently with elongate terminal setae. Cervix dark, probably well sclerotized ( Fig. 4A, B, E, F ).

Head coloration. Mandible and maxilla brownish basally. Anterodorsal surface of head brownish, with a pair of pale curved at base of each scape, from posterior and meet each other, nearly Y-shaped, and a pair of slender pale bands near each eye; integument around and between stemmata dark brown. Venter with sclerites margin dark brown; intersegmental membrane pale. Antenna with scape, base of pedicel brownish; pedicel pale, with annulations brownish; flagellum brownish to amber. ( Fig. 4A, B, E, F ).

Thorax. Broad, dorsoventrally thickened, each with a pair of LTs; LTs robust, rounded distally, bearing robust LS, with sparse acute setae dorsally; prothorax with a pair of dark brown band and a vertical brown band, meso- and metathorax each with a pair of black spots. Legs stocky, pale; claws dark ( Fig. 4 E, F, G ).

Abdomen. Segments A1–A6 broad, thick; together with thorax forming large, densely setose, dorsal arch of body; A1 with subsegment, without LTs, dorsally about as long and wide as metathoracic posterior subsegment, excluding LTs. Segments A2–A6 each with two subsegments dorsally; LTs round, spherical distally, bearing robust, curved LS brown distally, and smaller, hooked setae dorsally. Segments A7–A10 with each segment narrower than A6, with sparse, short, acute setae. A8 with small lateral LTs bearing short, slender, acute setae; spiracles at base of segment. A9, A10 without LTs, short, slender, acute setae present ( Fig. 4G ).

Type material. Holotype ♁, CHINA, Guangdong, Zhanjiang, sisal fields of South Subtropical Crops Research Institute CATAS, 21°17′N, 110°29′E, VI.2019, Ziyuan Li ( CAU); paratypes 5♁ 6♀, same data as holotype ( CAU).

Larval specimens examined. First and second instar, 6 individuals; third instar, 4 individuals. All larvae reared from the eggs laid by female adults collected from same locality as holotype ( CAU).

Etymology. The specific epithet refers to Latin, roseus and frons, means reddish frons, based on the reddish frons of the new species.

Distribution. China (Guangdong).

Remarks. Beside the new species, there are only six species in Apertochrysa without tignum: A. afghanica Hölzel, 1973 , A. eremita Kimmins, 1955 , A. eurydera Navás, 1910 , A. joannisi Navás, 1910 , A. puncticollis Banks, 1940 and A. umbrosa Navás, 1914 . The new species can be identified from these species by the reddish frons and gena without dark spots. Concerning the absence of tignum in Apertochrysa, Breitkreuz et al. (2021) mentioned that such absence may be due to some unknown artificial causes, such as incidental loss during dissection. However, we here confirm that the absence of tignum in the new species is of natural condition based on careful examination of multiple males. Thus, for the other Apertochrysa species without tignum, we cannot simply rule out the natural loss of this genital sclerite, and should clarify this problem by reexamination of more specimens.

COI barcode sequence.

AATAATATAGTAATAGCTCCTGCTAAAACAGGTAATGATAATAAAAGTAATAAAGCTGTAATAACA ACTGACCAAACAAATAAAGGTATTCGATCTAAAGTTATATAACTTAATCGTATATTAATAACTGTGG TAATAAAATTAACAGCTCCTAAAATAGAAGAAATTCCAGCTAAATGTAAACTAAAAATAGCTAAAT CAACAGATGCTCCAGCATGAGCAATTCTTGCAGAAAGAGGGGGGTATACAGTTCATCCTGTTCCAGC TCCTCTTTCTACTATTGAAGATGCTAGGAGTAGAGTTAAAGAAGGAGGTAATATTCAAAAACTTATA TTATTTATACGAGGAAAAGCTATATCAGGAGCTGCTAATATTAAAGGAACTAATCAATTACCAAATC CTCCAATTACAATAGGTATTACTATAAAAAAAATTATAATAAAAGCATGAGCAGTAACAATTACAT TGTAAATTTGATCATCACCAATTAATGATCCTGGTTGACCTAATTCAGCTCGAATTAATAAACTTAA ACTTGTACCTACTAATCCAGATCAAATTCCAAAAATAAAATATAAAGTTCCAATATCCTTATGGTTA GTTGAAAATAATCA

Figures

FIGURE 2. Apertochrysa roseusfrontata sp. nov., holotype male (A–D) and paratype male (E).A. habitus, dorsal view; B. head and thorax, dorsal view; C. head and prothorax, dorsal view; D. head and prothorax of fresh specimen, lateral view; E. head, frontal view; F. thorax and forewing of fresh specimen, dorsal view.Abbreviations:A, anal veins; C, costa CuA, cubitus anterior; CuP, cubitus posterior; MA, media anterior; MP, media posterior; PsC, pesudocubitus; PsM, pesudomedia; RA, radius anterior; RP, radius posterior; Sc, subcosta; ig, inner gradate; im, intramedian cell; og, outer gradate.

FIGURE 3. Apertochrysa roseusfrontata sp. nov. A. male terminalia, lateral view; B. female terminalia, lateral view; C. male genitalia, lateral view; D. male genitalia, lateral view; E. gonapsis, dorsal view; F. hypandrium internum, dorsal view; G. spermatheca, lateral view; H. subgenitale, ventral view. Abbreviations: cc, callus cerci; ent, entoprocessus; gl, gonapophysis lateralis; g.ap., gonarcal apodeme; gst, gonosetae; mu, mediuncus; sd, spermathecal duct; sg, subgenitale; sp, spermatheca; S7, sternite 7; S8+9, sternites 8+9; T7 and T8, tergites 7 and 8; T9+e, tergite 9+ectoprocts.

FIGURE 4. Apertochrysa roseusfrontata sp. nov. A. third instar larva, dorsal view; B. third instar larva, ventral view; C. first instar larva, head and thorax, dorsal view; D. first instar larva, head and thorax, lateral view; E. third instar larva, head, dorsal view; F. third instar larva, head and thorax, lateral view; G. third instar larva, habitus, lateral view. Abbreviations: co, cardo; cx, cervix; gen, gena; int, intermandibular marking; l.p., labial palpus; mb, mandible; mx, maxilla; ped, pedicel; pg, palpiger; sc, scape; stp, stipes; S1–S12, primary cranial setae 1–12; LS, setae on lateral tubercle; LT, lateral tubercle; SMS, submedian setae.