Atheroides vallescaldera Miller & Jensen

Miller, Gary L., Jensen, Andrew S., Metz, Mark A. & Parmenter, Robert R., 2014, A new species of Atheroides Haliday (Hemiptera, Aphididae) native to North America, ZooKeys 452, pp. 35-50 : 42-45

Taxon classification Animalia Hemiptera Aphididae

Atheroides vallescaldera Miller & Jensen sp. n.

Diagnosis.

This new species can be distinguished from other species in the genus by the following combination of characters: setae on the dorsum flabellate and dentate, and arranged in rows; dorsum sclerotized with rugose sculpturing; marginal setae of abdominal tergites I-VI easily visible, longer than width of hindfemur at middle, acuminate; empodial setae flat, but with base and apex of equal width, not spatulate.

Description

(slide-mounted specimens). Apterous vivipara (Figs 4-11, Table 2) (n = 2): Body at least 3 times longer than wide, dorsum rugose, dorsal setae on segments I-VII 0.018-0.058, mostly dentate and flabellate with some acuminate, arranged in rows, marginal setae acuminate, longer than width of hindfemur at middle, present on all abdominal segments. Head (Fig. 6) rectangular, flattened dorsoventrally and frons flat with bluntly pointed projections, one medial projection more prominent, rugose; setae acuminate on front and sides and denticulate (Fig. 8) dorsally; antennal tubercle undeveloped, basal antennal articulation flush with side of head; eyes slightly inset, eye outer margin almost flush with head margin, sometimes partially obscured dorsally, triommatidium outer margin projecting only as far as eye outer margin. Antenna (Fig. 5) 5-segmented, not reaching hind margin of prothorax, without secondary sensoria, antennal setae length usually subequal to width of corresponding antennal segment or less at middle of segment. Ultimate rostral segment (Fig. 7) with 2 pairs of primary setae and 1 pair of secondary setae. Basitarsi with 1 stout spine and 4 acuminate setae, one longer than basitarsus, the rest subequal to basitarsus; empodial setae flat, but base and apex of equal width, not spatulate (Fig. 10). Siphunculus flush with the surface of tergite V, without any elevation above the surface of the cuticle, orifice surrounded by a thickened band of cuticle. Tergite VIII (Fig. 9) broadly rounded, extending posteriorly so that it covers cauda, with robust, acuminate marginal setae. Cauda indistinct, obscured by setae of tergite VIII. Anal fig slightly emarginate, genital slightly emarginate (Fig. 11) with numerous irregularly arranged setae. Morphometric data are in Table 2.

DNA barcode (COI) for the holotype and one paratype contains 652 nucleotides (GenBank # KJ737374):

GAACTTTATATTTTTTATTTGGAATTTGATCAGGACTAATTGGTTCTTCACTAAGAATTTTAATTCGATTAGAATTAAGACAAATTAATTCAATCATTAATAATAATCAATTATATAATGTTATCATTACAATTCATGCATTTATTATAATTTTTTTTATAACTATACCAATTGTAATTGGTGGATTTGGAAATTGATTAATCCCTTTAATAATAGGATGCCCTGATATATCATTCCCACGATTAAATAATATTAGATTTTGAATACTTCCACCAGCATTAATATTTATAATTATAAGTTTTATAATTAATAATGGAACAGGAACAGGATGAACAATTTACCCCCCTCTATCTAACAATATTGCCCATAATAATATTTCTGTTGACTTAACAATTTTTTCTCTACATTTAGCAGGAATCTCATCAATTTTAGGAGCAATCAATTTTATTTGCACAATTATAAATATAATACCTAATAATATAAAAATTAATCAAATTCCTCTTTTCCCTTGATCTATTTTAATTACAGCAATCTTATTAATTTTATCTTTACCTGTATTAGCAGGTGCAATTACTATACTTTTAACTGATCGAAATCTTAATACTTCATTTTTTGATCCTTCAGGAGGTGGAGACCCTATCTTGTATCAACA

Alate vivipara and male: unknown.

Ovipara (n = 8): Dorsal abdominal setae on segments I-VII 0.015-0.070. With 18-27 circular pseudosensoria on each hindtibia predominantly organized in pairs that are 8-shaped, others are single circles or triplets (conjoined pairs or triplets are still counted as single pseudosensoria). Otherwise similar to apterous vivipara. Morphometric data are in Table 2.

Etymology of specific epithet.

The specific epithet, vallescaldera, is derived from the locality in which the specimens were collected, the Valles Caldera National Preserve, and should be considered a compound noun in apposition.

Specimens examined.

Type-locality. USA: NEW MEXICO: Sandoval Co., near unit 12, lower Santa Rosa Creek watershed, a perennial stream tributary of the Rio San Antonio, 35.951; -106.521, VCNP# 144, 23.ix.2010, 2,595m, A. Jensen coll., ex grass in open meadow next to Santa Rosa Creek, dominated by sedges, grasses, rushes and a variety of forbs (Fig. 2).

Holotype apterous vivipara (Figs 4-11): Slide-mounted in balsam USNMENT 00826485.

Original label: "New Mexico: Valles Caldera Nat’l Preserve Near Unit 12 22 Sept. 2010 ex: grass in open meadow A. Jensen coll. SEL VCNP#144 Balsam"

Paratypes: same data as holotype (1 apterous vivipara USNMENT 00826486, 8 oviparae USNMENT 00826487-89, USNMENT 00826480-84).

Host plants and habitat.

Unknown bunch grass. All other known Atheroides spp. feed on a variety of grasses ( Poaceae ), sedges ( Cyperaceae ) and rushes ( Juncaceae ) ( Wieczorek 2009). On the VCNP, there are 88 taxa of grasses, 31 taxa of sedges, and 11 taxa of rushes (includes subspecies and varieties). Among these plant taxa at the collection locale are common host plants of other Atheroides spp., including Deschampsia caespitosa , Phleum spp., Festuca spp., Carex spp., and Juncus spp.