Bracon eugeniephillipsae Sharkey

Sharkey, Michael J., Janzen, Daniel H., Hallwachs, Winnie, Chapman, Eric G., Smith, M. Alex, Dapkey, Tanya, Brown, Allison, Ratnasingham, Sujeevan, Naik, Suresh, Manjunath, Ramya, Perez, Kate, Milton, Megan, Hebert, Paul, Shaw, Scott R., Kittel, Rebecca N., Solis, M. Alma, Metz, Mark A., Goldstein, Paul Z., Brown, John W., Quicke, Donald L. J., Achterberg, C. van, Brown, Brian V. & Burns, John M., 2021, Minimalist revision and description of 403 new species in 11 subfamilies of Costa Rican braconid parasitoid wasps, including host records for 219 species, ZooKeys 1013, pp. 1-665: 1

publication ID

http://dx.doi.org/10.3897/zookeys.1013.55600

publication LSID

lsid:zoobank.org:pub:CFDCEFBB-5230-4033-9D46-E302F66E9886

persistent identifier

http://treatment.plazi.org/id/4A3D13F7-A4A5-4A13-B11A-10A2F17F5D90

taxon LSID

lsid:zoobank.org:act:4A3D13F7-A4A5-4A13-B11A-10A2F17F5D90

treatment provided by

ZooKeys by Pensoft

scientific name

Bracon eugeniephillipsae Sharkey
status

sp. nov.

Bracon eugeniephillipsae Sharkey   sp. nov. Figure 44 View Figure 44

Diagnostics.

BOLD:ADA9990. Consensus barcode. GTTTTATATTTTTTATTTGGTTTATGATCAGGAATTTTAGGTCTATCAATAAGTTTAATTATTCGATTAGAATTAGGTATACCAGGCAGGATATTAGGTAATGATCAAATTTATAATAGTATTGTAACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAATTGGTTATTGCCTTTAATATTAGGAGCTCCTGATATGGCATTYCCTCGTTTAAATAATATAAGATTTTGATTAATTTTCCCTTCTTTAATTTTATTATTAATAAGTAGGATTTTAAATGTAGGAGCAGGTACAGGTTGGACAGTTTATCCTCCTTTATCTTCTTCATTAGGACATAGAGGTTTATCAGTTGATTTAGCTATTTTTTCTTTACATATAGCTGGTGTATCTTCAATTTTAGGAGCAATTAATTTTATCACTACAATTTTAAATATGCATTTAAATACTTTAAARTTAGATCAATTAACTTTAATAATTTGATCAATTTTTATTACTGTAATTTTATTATTGTTATCTTTACCAGTTTTAGCAGGGGCTATTACTATATTATTAACTGATCGA.

Holotype ♀.

Guanacaste, Sector Pailas Dos, PL12-9, 10.76, -85.3341, 809 meters, Malaise trap, 6/ii/2014. Depository: CNC.

Host data. None.

Holotype voucher code. BIOUG28680-G05.

Paratypes.

BIOUG28680-A07, BIOUG28680-E08, BIOUG29219-D01.

Etymology.

Bracon eugeniephillipsae   is named to honor Eugenie (Jenny) Phillips for her many years of dedicated curatorial and taxonomic efforts for the development of the former INBio arthropod collection, now in the Museo Nacional de Costa Rica, and now her administrative development of BioAlfa, the program to DNA barcode all of Costa Rican eukaryote biodiversity.

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Hymenoptera

Family

Braconidae

Genus

Bracon