Terebellides williamsae Jirkov, 1989

Barroso, Maria, Moreira, Juan, Capa, Maria, Nygren, Arne & Parapar, Julio, 2022, A further step towards the characterisation of Terebellides (Annelida, Trichobranchidae) diversity in the Northeast Atlantic, with the description of a new species, ZooKeys 1132, pp. 85-126 : 85

publication ID	https://dx.doi.org/10.3897/zookeys.1132.91244
publication LSID	lsid:zoobank.org:pub:4168C32E-37A7-4912-A909-4912E69030AA
persistent identifier	https://treatment.plazi.org/id/8176354B-1320-50CD-A3DF-013FC3224B8F
treatment provided by	ZooKeys by Pensoft
scientific name	Terebellides williamsae Jirkov, 1989
status

Treatment

Terebellides williamsae Jirkov, 1989 View in CoL

Figs 2D View Figure 2 , 3E View Figure 3 , 9 View Figure 9 , 10E View Figure 10 , 11 View Figure 11 , 12 View Figure 12 , 14 View Figure 14 , 15 View Figure 15

Terebellides williamsae Jirkov, 1989: 124.

Terebellides williamsae Species 2 - Nygren et al. 2018: 18-22, figs 6, 10.

Material examined.

20 specimens (Suppl. material 1), Skagerrak ( GNM14639, GNM15107, GNM15108 ); Barents Sea (ZMBN116246, ZMBN116247, ZMBN116248, ZMBN116249, ZMBN116251, ZMBN116252, ZMBN116253, ZMBN116254, ZMBN116255, ZMBN116257, ZMBN116260, ZMBN116262, ZMBN116263, ZMBN116266, ZMBN116269, ZMBN116270, ZMBN116271) .

GenBank accession numbers of material examined (COI).

MG024957, MG024958, MG024959, MG024960, MG024961, MG024962, MG024963, MG024964, MG024965, MG024966, MG024967, MG024968, MG024969, MG024970, MG024971, MG024972, MG024973, MG024974, MG024975, MG024976, MG024977, MG024978, MG024979, MG024980, MG024981, MG024982, MG024983, MG024984, MG024985, MG024986, MG024987, MG024988 .

Diagnostic features of studied material.

Complete individuals ranging from 9.0-34.0 mm in length (Fig. 9 View Figure 9 ). Branchial dorsal lobes lamellae provided with well-developed papillary projections and branchial ventral lobes provided with short posterior filaments, 50.0 µm in length (Figs 3E View Figure 3 , 14A View Figure 14 ). Between 16-18 lamellae on dorsal lobes (Fig. 14A, B View Figure 14 ). Ciliary tufts present in inner face of lamellae (Fig. 14B, C View Figure 14 ). Ventral branchial lobes hidden in between dorsal ones but sometimes discernible below (Fig. 14A View Figure 14 ). Lateral lappets present on TC 1-4; dorsal projection of thoracic notopodia on TC 2-4 (Fig. 14A View Figure 14 ). White ventral colouration present on TC 1-4 (Figs 2D View Figure 2 , 3E View Figure 3 ). Geniculate chaetae in TC 5, acutely bent, with well-marked capitium (Fig. 15B View Figure 15 ). Ciliated papilla dorsal to thoracic notopodia observed in TC 7 (Fig. 14D, E View Figure 14 ). From TC 7, neuropodia with one row of type 1 thoracic uncini per torus, with rostrum/capitium length ratio of ~ 2:1 and capitium with a first row of two or three large teeth, followed by many smaller teeth (Fig. 15C, D View Figure 15 ). Abdomen with 38-44 pairs of neuropodia with type 1A uncini (Fig. 15E, F View Figure 15 ).

Colour pattern.

MG staining pattern characterised by compact green colourant in SG 1-5 and SG 7-13, SG 6 white and SG 14 striped, J-shaped glandular regions in SG 3-5 (Fig. 12 View Figure 12 ). Similar to pattern 2.

Nucleotide diagnostic features.

All sequences of Terebellides williamsae share and are distinguished from other available Terebellides sequences in unique combinations of nucleotides (underlined) at the given position of our alignment: 59-62: TATC, 75-96: TGGACAACCTGGGGCATTCCTG, 132-144: TCATGCTTTTTTA, 153-157: TTTCC, 216-234: TGCTCCTGATATAGCTTTC, 264-277: CCTCCCTCCAGCTT, 315-318: GGTT, 327-342: CTGAACAGTATACCCC, 381-399: AGATTTGGCTATTTTTTCT, 414-432: TATCTCCTCTATTCTTGGC, 450-454: TACA, 515-529: AAAAATCACTACCA, 543-573: TTCACTTCCTGTATTAGCAGGAGCTATTACA, 600-609: CACTTCCTTT, 630-640: CGACCCAATTT.

Type locality.

Barents Sea, Norway, 74°30'N, 28°00'E ( Jirkov 1989).

Distribution and bathymetry.

Barents Sea, Greenland Sea, Norwegian coast and shelf, Skagerrak; at depths of 178-612 m but most of the specimens (97%) were collected above 200 m (Figs 10E View Figure 10 , 11 View Figure 11 , Suppl. material 1).

Remarks.

Terebellides williamsae is a medium-sized species, reaching up to 34 mm in length; it is characterised by the lack of papillae on margins of branchial lamellae and by having branchiae of type 2 and posterior filaments in ventral branchial lobes, thoracic uncini of type 1 and abdominal uncini of type 1A (Table 1 View Table 1 ). All these features are shared with T. gracilis ; in fact, Parapar et al. (2011) suggested this species as a synonym to T. gracilis after examining specimens from Iceland. Nygren et al. (2018) pointed out that there were no morphological differences between both species, but their molecular analyses indicate that specimens from the Barents Sea ("Species 2") would correspond to T. williamsae . Nygren et al. (2018) suggested therefore that T. williamsae might be a valid species and different from T. gracilis ("Species 3", see below). Here, examination of specimens of T. williamsae show that they differ from T. gracilis in the number of chaetigers with white ventral colouration, i.e., in T. williamsae white colouration is present in TC 1-4 while in T. gracilis it is only present on TC 4.