Eurythenes gryllus

D’Acoz, Cédric D’Udekem & Havermans, Charlotte, 2015, Contribution to the systematics of the genus Eurythenes S. I. Smith in Scudder, 1882 (Crustacea: Amphipoda: Lysianassoidea: Eurytheneidae), Zootaxa 3971 (1), pp. 1-80 : 23-41

Eurythenes gryllus ( Lichtenstein in Mandt, 1822)

( Figs 12–26 )

Gammarus gryllus Lichtenstein in Mandt, 1822: 34; Stebbing, 1888: 116.

Eurytenes magellanicus .— Lilljeborg 1865a: 11, pls. 1–3.—1865 b: 6 (= not Eurythenes magellanicus (H. Milne Edwards, 1848)) .

Lysianassa gryllus .— Goës, 1866: 517 –518, fig. 1 (holotype).

Eurytenes gryllus .— Boeck, 1871: 105 –106 [25–26 on reprints].— Boeck, 1872: 144 –146.

Eurythenes gryllus .— Stebbing, 1906: 73 (in part).— Stephensen, 1933: 12, in part, figs. 4–5 only.— Chevreux, 1935: 50 –52, in part, pl. 1 fig. 6 only [Lofoten].— Bowman & Manning, 1972: 193, figs. 2–5, in part (Arctic material only).— Rauschert, 1985: 319, fig. 1, pl. 1–2.— Stoddart & Lowry, 2004: 429 , in part, figs. 1–3 (holotype), figs. 8–11, not figs. 4–7 (= Eurythenes magellanicus (H. Milne-Edwards, 1848)) .— Havermans, 2014: 441, in part (clade Eg1), photo 1.

Eurythenes gryllus clade Eg1.— Havermans et al., 2013: 12 –13, fig. 5 (2A, 3A, 6A, 7A, 8A, 9A)

Euryporeia gryllus .—G.O. Sars, 1891: 86, pl. 39.

Not Eurythenes gryllus .— Chevreux, 1889: 298, unnumbered fig. (identity unclear).— Barnard, 1961: 35, figs. 5–7 (possibly E. sigmiferus sp. nov. and E. thurstoni Stoddart & Lowry, 2004 ).— Senna, 2009: 83, figs. 1–2 (possibly partly E. magellanicus ).

Not Euryporeia gryllus .— Chevreux, 1900: 24, pl. 14 fig. 4 (identity unclear but definitely not E. gryllus ).

Material examined. HOLOTYPE. Greenland Sea, regurgitated by a Northern Fulmar Fulmarus glacialis (Linnaeus, 1761) : 1 female in alcohol, exoskeleton in fairly good condition, tissues digested, 81 mm, ZMB 1265.

ARCTIC AND NORWEGIAN SPECIMENS. No locality (presumably from Greenland shark stomachs): 4 specimens, Naturhistorisk Museum, Oslo, Reg. nr F14910.—No locality: 2 specimens, TSCrZ 1330 [det. as Euryporeia gryllus (Mandt) by S.S. [obviously Sparre Schneider].—Utenfor Kvalö. Av magen av en stor fisk (haa?) [outside Kvalö. from the stomach of a big fish (shark?)], probably collected around 1910: 3 specimens, leg. H. Larsen, TSCrZ 2723.—NORBI-expedition, Lofoten basin, 3000 m, presumably July–August 1975, leg. Wim Vader: 1 specimen about 60 mm [pointed eye still distinct], TSCrZ 8591.—RV Polarstern, expedition PS64, ARK- XIX /3, sta. 412-1, Eastern Fram Strait, 79°02'N 04°12'E, 2464 m, 23.vii.2003, ROV: 1 small specimen, absolute alcohol RBINS, INV. 12789.—ARK-XIX/3, sta. 423-1, Eastern Fram Strait, 79°03'N 04°16'E, 2461 m, 25.vii.2003, baited trap: about 12 small specimens, absolute alcohol, individuals not isolated, RBINS, INV. 12785; 4 specimens were sequenced: Arctic-a2, EG- 01121012, JX887132 ( COI), JX887084 (28S), JX887060 (16S); Arctic-a3, EG- 01121013, JX887127 ( COI), JX887085 (28S), JX887064 (16S); Arctic-a4, EG- 01121014, JX887128 ( COI), JX887086 (28S), JX887063 (16S); Arctic-a5, EG- 01121015, JX887130 ( COI), JX887087 (28S), JX887060 (16S); Arctic-a6, EG- 01121016, JX887126 ( COI), JX887084 (28S), JX887060 (16S).—ARK-XIX/3, sta. 423-1/425-1, Eastern Fram Strait, 79°03'N 04°16'E, 2461 m, 25.vii.2003, baited trap: 5 small specimens, absolute alcohol, RBINS, INV. 12786; 2 specimens were sequenced: Arctic-b1, EG-0112109, JX887131 ( COI), JX887084 (28S), JX887060 (16S); Arctic-b2 EG- 01121010, JX887132 ( COI), JX887083 (28S), JX887060 (16S).—ARK-XIX/3, sta. 425-1 (lander B1), Eastern Fram Strait, 79°03'N 04°16'E, 2461 m, 25.vii.2003, baited trap: 7 small specimens, absolute alcohol RBINS, INV. 12788.—ARK-XIX/3, sta. 448/451, 78°37'N 05°04'E, 2355 m, 29–30.vii.2003, 'traps Victor': about 12 small specimens, absolute alcohol [this coordinates look strange as sta. 448-1 and 451-1 are a ROV station ( Klages et al. 2004), but it could be that the traps were attached to the ROV], RBINS, INV. 12787.—RV Jan Mayen, Svalbard, 82°26'N 20°52'E, 1660 m, 25.viii.2004, baited trap: 5 specimens, alcohol fixed, individuals not isolated, coll. Jørgen Berge, RBINS, INV. 122783; Arctic-c3, EG-1810119, JX887147 ( COI), JX887061 (16S); Arctic-c4, EG- 18101110, JX887147 ( COI), JX887109 (28S), JX887060 (16S); Arctic-c5, EG- 18101111, JX887149 ( COI), JX887060 (16S); Arctic-c6, EG- 18101112, JX887147 ( COI), JX887109 (28S), JX887060 (16S); Arctic-c7, EG- 18101113, JX887150 ( COI), JX887096 (28S), JX887060 (16S).—Same station: 5 other medium-sized specimens, coll. Jørgen Berge, formerly TSZCr 13640, now given to RBINS, INV. 122782.

ANTARCTIC SPECIMENS. RV Polarstern, expedition PS61, ANT-XIX/3-4, ANDEEP I and II, sta. 100-1, 61°25'S 58°53'W, 2280 m, 13.ii.2002, baited trap: 1 mid-sized specimen, absolute alcohol, RBINS, INV. 12790; KGI-a1, EG-0112106, JX887134 ( COI), JX887087 (28S).—RV Polarstern, expedition PS69, ANT-XXIII/8, sta. 683-1/684-1, between King George Island and tip of the Antarctic Peninsula, 62°58'S 57°58'W, 822–839 m, fish traps, 04–07.i.2007: 23 large specimens, formalin fixed, leg. C. d'Udekem d'Acoz & H. Robert, RBINS, INV. 122778.—ANT-XXIII/8, sta. 683-1, 62°58'S 57°58'W, 822–839 m, fish traps, 04–07.i.2007: 1 large specimen, absolute alcohol, leg. C. d'Udekem d'Acoz & H. Robert, RBINS, INV. 122784.—RV Polarstern, expedition PS77, ANT-XXVII/3, CAMBIO, sta. 219-1/223-1, King George Island, 62° 17.21°S 58°17.49'W to 62°17.10'S 58°16.82'W, 980–1033 m, baited trap, 22–24.ii.2011: 23 specimens, alcohol fixed coll. C. Havermans & H. Robert, RBINS, INV. 122779.—Same station: 1 specimen dissected on one side (illustrated specimen 1), alcohol fixed coll. C. Havermans & H. Robert, RBINS, INV. 122781.—Same station: 1 specimen with some legs dissected (illustrated specimen 2), alcohol fixed coll. C. Havermans & H. Robert, RBINS, INV. 122780.

Type locality. Greenland Sea.

Voucher DNA sequences. Arctic (topotypic) specimen, Arctic C6.

COI (GenBANK JX887147 ):

GACTTTGTACTTCATCTTAGGTGCCTGAGCTAGAGTTGTCGGAACATCTCTTAGTGTAATTATTCGGTC TGAGCTCAGTGGACCGGGAAACCTAATTGGAGATGATCAAATCTATAATGTTATAGTAACTGCCCACG CCTTTGTTATAATCTTCTTTATAGTTATACCTATTATAATTGGTGGTTTTGGAAATTGATTGGTCCCCCTTA TACTCGGGAGACCCGACATAGCTTTCCCGCGTATAAACAACATAAGATTCTGATTATTACCGCCCTCTC TAACCCTATTATTAATAAGAGGTCTAGTAGAAAGAGGTGTAGGGACTGGTTGAACAGTTTACCCCCCC TTAGCTGCGGCTGCGGCTCACAGGGGAGGCTCTGTTGATCTGGCTATCTTCTCTCTTCACCTAGCAGG TGCTTCTTCCATCTTGGGTGCCATTAATTTTATCTCCACTGTAATTAACATGCGAACCCCTGGTATATATA TGGACCGGGTCCCTTTATTTGTTTGGTCTGTCTTCATCACAGCCATTCTACTCCTCTTATCTCTACCCGT ACTAGCAGGGGCAATCACCATACTCCTAACAGACCGAAACCTTAATACTTCCTTCTTTGATCCTAGGG AGGAGGTGACCCTATCCTTTACCAGCACCTATTC

28S (GenBANK JX887109 ):

GCCTGCGGCGGAATGTTGCGTTAAGGGAAAGGTCGTAGTCAAACCCTACAACCACACGAACTCTAAG TCTGCCACGAATAGGCTATCCCAACTAACGGCGGGAGTGACTCCACGGAGGGTGTAAGACCCGTGTG GGCGTGTGTCAATGTTGTATGGGCTCGGCCTCTTCCCTGAGAGTCGCGTTGCTTGAGCATGCAGCGCT AAGCAGGTCGTAAACTCGATCTAAGGCTAAATATTTCCACAGGACCGATAGCAAACAAGTACCGTGA GGGAAAGTTGAAAAGCACTCTGAAGAGAGAGTCAAAAGACCGTGAAACCGCTCAGAGTATAAGCCC ATGGAGCTTGGAAGGCTTCCGCAGCGGCGTGCATCCCTTGTGGGTGTACGTGAGGACATTGTGAAAG GTTCGTTAGGCAGGGGGCATTGAGTTTGCTACCCACCGCCGTGCTGGTGAATTGCCTGGGAGGAGTC GTGCCTCGGTGCGGCTCTCTTCTGGGTCGTTCTCATGTGTATGAACGTTCAAGGACAATGACCTAATG CGGTACGCCCACCACAGTTTGTTGTGAGGTCACCCACAGGCTCAAACTGTCGATCGTGTGTTCAGTG CGTGGCCTGAATTGTGTGCCGTTCGTAATATAGTGCCACCGTTATCTGTGTGGCGCTCCGGCATGCAGT CGCGCGCTGGACCAGGCGACGAAACGAGTATATCCTGGTATGATCCTCGTGCGACAATCTGATTCTGA CCGAGTGTACATCGCTACCGTTTGGCTCTGCCCATGTGTCGGGCGGAGTCAGGAGGTGCAACCTGATT GTTTGGTCCTCTGAACGATGTAACAGTCGATAAGATCTCAGTCGAGGTAGCGAACGACTCGCGTGGTG TTAAGTCCAGCACCATCGGTCACGTCTCGAAACACGGGCCAAGGAGTATAGCATGTGTGCAAGTCTA AGGGTCTCACAAAACCCGCAGGCGAAGTGAAAGCAAATGGTGTGGCGGGAGCGCTACGGCAATCTC GTCAGCCTTGTGGTGGTCAAAAACTACTCGGCTTAAACCGAGCTGATCCTGTTCTGTTGGCAATGTCT CAAGGCAGGCGCAAGCTCCGGGCTCACATACCAACACTGGCATCCTCACGGGTGCTGTGTTGTGAGC ACCGTGGAGCATGCATGCTATAACCCGAAAGATAGTGAACTATGCCTGGCGAGGGCGAAGCCCCAGG AAACTGGGGTGGAGGC

16S (GenBANK JX887060 ):

TGCTATAAGGGTAGTGTATGGTAAGGCCTGCCCAGTGATTAATTAAACGGCTGCGGTATATTGACCGTG CTAAGGTAGCATAGTCATTTGTCTTTTAATTGGAGGCTGGAATGAAGGGTTTAACAAAAGATAGTGTCT TTATTTTAAATTTGTAATTTGTAATAAGAGTAAAAATACTCTGGTGTAATTAAGGGACGACAAGACCCT AAAAGCTTTATTTTTAACATAAGTTTGAGTTTAAAGTAGAACAGAGAGTTTAACTGGGGTAGTTTTTTTG TAAAATCTGAGGTTGTAAAAGACATGTAAGGTGGGATTAGGTCCTTTAGATAAGGATAATTTGAGTGAG TTACTTTAGGGATAACAGCGTAATAGTCCTAGGGAGATCGTATCTATGGGATTGATTGCGACCTCGATGTT GAATTAAAAGCTCAGTGTAGAGTAGAAGCTACAGGGTGAGGGTTTGTTCAACCTTTAAATTTTTA

Description (holotype female, 81 mm). Body: pleosomite 3 with anterior concavity; other pleosomites and pereonites without anterior concavity.

Head: anterior lobe of head looking as strongly produced on left side, but weakly produced on right side; eye completely disappeared (digested as are all soft tissues).

Maxilliped: lost.

Gnathopod 1: coxa straight anteriorly; leg missing.

Gnathopod 2: coxa broad and weakly curved ventrally; propodus stout, not expanded distally, 3.3 x as long as wide, palm convex, strongly oblique and oriented outwards, defined by 2 stout spines.

Pereopod 3: coxa rather broad, 1.6 x as deep as wide.

Pereopod 4: coxa moderately broad, 1.1 x as deep as wide; junction between anterior and ventral border rounded, with very weak angular discontinuity; ventral border slightly curved; posteroventral border slightly convex and distinctly oblique.

Pereopod 5: basis with posterior border nearly smooth; merus broad, 1.7 x as long as wide; propodus stout, 5.1 x as long as wide, with 9 groups of spines anteriorly.

Pereopod 7: basis rather broad, with posterior border moderately expanded, with posterior border weakly crenulated, with ornamentation of anterior border normal, 1.5 x as long as wide, with posterodistal corner of lobe scarcely produced and rounded, with weak angular discontinuity, ratio length of lobe of basis / total length of basis = 0.22; merus of normal stoutness, 1.9 x as long as wide, averagely and fairly regularly convex posteriorly; propodus stout, 4.8 x as long as wide, with 11 groups of spines anteriorly; dactylus of normal stoutness.

Epimeron 3: ventrally well rounded, without posteroventral tooth.

Description (fresh specimens).

Body: pleosomite 3 with anterior concavity; other pleosomites and pereonites without anterior concavity.

Head: anterior lobe of head weakly produced; ventral corner of eye sharp and pointing downwards.

Mandible: article 2 of palp scarcely expanded and weakly tapering.

Maxilliped: inner plate with 3 (sometimes 4 on one side) non-protruding nodular spines.

Gnathopod 1: coxa straight anteriorly (adult) or scarcely convex (immature); basis broad, 2.5 x as long as wide; palm of normal width, not produced (adult) or scarcely produced (immature).

Gnathopod 2: coxa broad and weakly curved ventrally; propodus elongate, not expanded distally, 3.5 x as long as wide, palm convex, strongly oblique and oriented outwards, defined by 3 to 4 spines.

Pereopod 3: coxa broad, 1.5 (immature) to 1.8 (adult) x as deep as wide; basis stout, 3.2 x as long as wide; propodus stout, 4.0 (adult) to 4.3 (immature) x as long as wide; dactylus of normal stoutness.

Pereopod 4: coxa very broad, 1.0 (immature) to 1.1 (adult) x as deep as wide; junction between anterior and ventral border bluntly angular; ventral border nearly straight in adult, slightly rounded in immature; posteroventral border straight (immature) or inconspicuously concave (adult), distinctly oblique (adult), or not oblique (immature); leg almost identical with pereopod 3.

Pereopod 5: basis with posterior border moderately but distinctly crenulated; merus broad in adult (much less so in immature), 1.6 (adult) to 1.8 (immature) x as long as wide, with posterior border forming a more or less regular curve; propodus stout, 4.9 (adult) to 5.3 (immature) x as long as wide, with 7 (immature) to 8 (adult) groups of spines anteriorly; dactylus of normal stoutness.

Pereopod 6: basis with posterior distinctly crenulated, merus stout in adult, less so in immature, 1.6 (adult) to 1.8 (immature) x as long as wide, with posterior border forming an extremely convex curve in adult especially in the middle, becoming distally more straight (much less convex and forming a more regular curve in immature); propodus stout, 5.4 (immature) to 5.5 (adult) x as long as wide, with 8 groups of spines anteriorly; dactylus of normal stoutness.

Pereopod 7: basis broad, with posterior border distinctly expanded in immature individuals, weakly expanded in adults, with posterior border distinctly crenulated, with ornamentation of anterior border normal, 1.35 (adult) to 1.45 (immature) x as long as wide, with posterodistal corner of lobe not produced and regularly rounded, ratio length of lobe of basis / total length of basis = 0.20 (adult) to 0.21 (immature); merus very broad in adult, 1.6 (adult) to 1.7 (immature) x as long as wide, very convex posteriorly in adult, especially in the middle, becoming distally more straight (less convex and more regularly curved in immature); propodus stout, 4.6 (immature) to 5.6 (adult) x as long as wide, with 8 (immature) to 11 (adult) groups of spines anteriorly; dactylus of normal stoutness.

Epimeron 3: ventrally well rounded, without posteroventral tooth.

Uropod 3: spines of distolateral angle of peduncle of normal length and stoutness.

Colour pattern. Very variable. Crimson red, orange, yellow or whitish with traces of pink. Eye pale yellow.

Size. Up to 126 mm (present material).

Distribution and depth range. Bipolar: Norwegian Sea, Greenland Sea, Arctic Ocean, Antarctica (Weddell Sea and north of Antarctic Peninsula, 839–3000 m. The E. gryllus material collected in the Arctic Ocean between 3785 and 3803 m by Bowman & Manning (1972) are apparently correctly identified and would represent the deepest record of the species. Possibly there is only one Eurythenes species in the Arctic Ocean, which descends deeper in this region in the absence of competition of congeneric species.

Biology. The species is a scavenger, which enters baited traps in large numbers. Literature accounts on the biology of E. gryllus are often based on other Eurythenes species or on mixtures of species. So, they should be interpreted with caution.

Remarks. When comparing the illustrations of the holotype of Eurythenes gryllus given by Stoddart & Lowry (2004) with the specimens from clade Eg1, some morphological differences can be observed, e.g. the anterior lobe of the head is longer and the coxa 4 is ventrally slightly more curved in the holotype compared with Eg 1 specimens of similar size. Upon a re-examination of the holotype, the drawings of Stoddart & Lowry (2004) have been proven to be correct. At first glance, the holotype does not look distorted. However, the significant differences between the appearance of the left and right anterior lobe of head indicates that alterations (due to digestion or long preservation) of the specimen did occur. The space between the left anterior lobe of head and the antennal lobe seems to be abnormally concave, so it seems more likely that the right (apparently shorter) anterior lobe of head represents the original condition, which conforms more Eg1.

The examination of the specimens from the Oslo Museum (presumably coming from the stomach of a Greenland shark) confirms that in partly digested specimens the apparent degree of projection of the anterior lobe of the head exhibits distortion (often unilaterally), rendering it more projecting than in normal conditions.

The northern fulmar, which ingested the holotype of E. gryllus was caught at an unspecified position in the Greenland Sea. It might have been sampled at a high latitude, since Mandt (1822) was travelling between Spitsbergen and Greenland during his expedition and reached 81°N. So far there is no evidence of Eurythenes clades other than Eg 1 in Arctic Europe. Hence, the holotype of E. gryllus and the clade Eg1 are considered herein as conspecific.

The specimen illustrated as Euryporeia gryllus by G.O. Sars (1891), from northern Norway, also requires comments. Morphologically it agrees well with the clade Eg1, except for the eyes, which are shown as ventrally rounded instead of pointed. G.O. Sars' (1891) drawings are known to be extremely accurate and in his account he explicitly mentions that the ocular pigments were well preserved. Nonetheless, the specimen examined could have been deviant or, despite Sars' statement, could have undergone some post mortem alterations since it was found in the stomach of a Greenland shark ( Somniosus microcephalus Bloch & Schneider, 1801 ).

While there is strong evidence that the clade Eg1 aka E. gryllus s.s. is the sole Eurythenes of the gryllus - complex occurring in the Norwegian Sea, the Greenland Sea and in the Arctic ocean (i.e. in the deep Arctic water mass), other species occur in the temperate North Atlantic, south of the Greenland Scotland Ridge. Molecular analyses using DNA sequences from GenBank ( Havermans et al. 2013) suggest the occurrence of E. maldoror sp. nov. and of an unknown clade/species Eg 8 in the temperate North Atlantic. Scarce morphological data point towards the same direction. Chevreux (1889) records two Eurythenes caught at 2000 m depth off the Azores, one of which was illustrated by a large-scale drawing of the head. The anterior lobe of the head is illustrated as very protruding, and the ventral lobe of the eye is rounded and points obliquely backwards, which differs from E. gryllus s.s. Unfortunately, Chevreux’s (1900) coloured illustrations of the two recorded specimens are not precise enough for further interpretation.

Figures

FIGURE 12. Eurythenes gryllus (Lichtenstein in Mandt, 1822), adult, female, holotype, 81 mm, Greenland Sea, ZMB 1265. A, anterior part of body (left side); B, head (right side); C, posterior part of body.

FIGURE 13. Eurythenes gryllus (Lichtenstein in Mandt, 1822), adult, female, holotype, 81 mm, Greenland Sea, ZMB 1265. A, right Gn 2; B, propodus of right Gn 2; C, chela of right Gn 2 (lateral view); D, idem (tip); E, chela of right Gn 2 (medial view); F, idem (tip).

FIGURE 14. Eurythenes gryllus (Lichtenstein in Mandt, 1822), adult, female, holotype, 81 mm, Greenland Sea, ZMB 1265. A, right Coxa 4; B, left P 5; C, right P 7; D, tip of propodus of right P 7.

FIGURE 15. Eurythenes gryllus (Lichtenstein in Mandt, 1822), adults, sex unrecorded. RV Polarstern, ANT-XXIII / 8, sta. 683 - 1 / 684 - 1, Bransfield Strait, 62 ° 58 ' S 57 ° 58 ' W, 822 – 839 m, RBINS, INV. 122778. A, red specimen (habitus); B, orange specimen (habitus), C, orange specimen (head). Photographs C. d'Udekem d'Acoz, RBINS, copyright RBINS.

FIGURE 16. Eurythenes gryllus (Lichtenstein in Mandt, 1822), female, 126 mm. ANT-XXVII / 3, sta. 219 - 1 / 223 - 1, King George Island, 62 ° 17 ' S 58 ° 17 ' W, 980 – 1033 m. A, RBINS, INV. 122780; B – G, RBINS, INV. 122781. A, head and appendages; B, upper lip and epistome; C, lower lip; D, left Md; E, right Md; F, righ Mx 1 (palp not flattened); G, Mx 2.

FIGURE 17. Eurythenes gryllus (Lichtenstein in Mandt, 1822), female, 126 mm. ANT-XXVII / 3, sta. 219 - 1 / 223 - 1, King George Island, 62 ° 17 ' S 58 ° 17 ' W, 980 – 1033 m, RBINS, INV. 122781. A, Mxp; B, tip of left inner plate (oral side); C, distomedial corner of left inner plate (oral face); D, tip of left inner plate (facial side).

FIGURE 18. Eurythenes gryllus (Lichtenstein in Mandt, 1822), female, 126 mm. ANT-XXVII / 3, sta. 219 - 1 / 223 - 1, King George Island, 62 ° 17 ' S 58 ° 17 ' W, 980 – 1033 m, A, C – E, RBINS, INV. 122781; B, RBINS, INV. 122780. A, left Gn 1; B, tip of left Gn 1; C, left Gn 2; D, propodus and dactylus of left Gn 2; E, chela of left Gn 2 (lateral view); F, idem (medial view).

FIGURE 19. Eurythenes gryllus (Lichtenstein in Mandt, 1822), female, 126 mm. ANT-XXVII / 3, sta. 219 - 1 / 223 - 1, King George Island, 62 ° 17 ' S 58 ° 17 ' W, 980 – 1033 m, RBINS, INV. 122781. A, left P 3; B, propodus and dactylus of left P 3; C, posterodistal spines of propodus of left P 3; D, left P 4; E, telson.

FIGURE 20. Eurythenes gryllus (Lichtenstein in Mandt, 1822), female, 126 mm. ANT-XXVII / 3, sta. 219 - 1 / 223 - 1, King George Island, 62 ° 17 ' S 58 ° 17 ' W, 980 – 1033 m, RBINS, INV. 122781. A, left P 5; B, left P 6; C, left P 7: D, posterodistal spines of propodus of left P 7.

FIGURE 21. Eurythenes gryllus (Lichtenstein in Mandt, 1822), female, 126 mm. ANT-XXVII / 3, sta. 219 - 1 / 223 - 1, King George Island, 62 ° 17 ' S 58 ° 17 ' W, 980 – 1033 m, RBINS, INV. 122781. A, left Ep 1; B, left Ep 2; C, left Ep 3; D, urosome with telson and U 3; E, left U 1; F, left U 2; G, left U 3; H, tip of left U 3; I, peduncle of left U 3 (ventral view, showing ventral spines).

FIGURE 22. Eurythenes gryllus (Lichtenstein in Mandt, 1822), presumably female, 50 mm, RV Jan Mayen, 82 ° 26 ' N 20 ° 52 ' E, 1660 m, RBINS, INV. 122783. A, head; B, lower lip (half of); C, left Md; D, tip of right Md; E, left Mx 1 (palp not flattened); F, tip of left inner plates (oral side).

FIGURE 23. Eurythenes gryllus (Lichtenstein in Mandt, 1822), presumably female, 50 mm, RV Jan Mayen, 82 ° 26 ' N 20 ° 52 ' E, 1660 m, RBINS, INV. 122783. A, left Gn 1; B, chela of left Gn 1; C, left Gn 2; D, propodus and dactylus of left Gn 2; E, chela of left Gn 2 (lateral side), F, chela of left Gn 2 (medial side).

FIGURE 24. Eurythenes gryllus (Lichtenstein in Mandt, 1822), presumably female, 50 mm, RV Jan Mayen, 82 ° 26 ' N 20 ° 52 ' E, 1660 m, RBINS, INV. 122783. A, left P 3; B, left P 4.

FIGURE 25. Eurythenes gryllus (Lichtenstein in Mandt, 1822), presumably female, 50 mm, RV Jan Mayen, 82 ° 26 ' N 20 ° 52 ' E, 1660 m, RBINS, INV. 122783. A, left P 5; B, left P 6; C, left P 7; D, propodus and dactylus of left P 7.

FIGURE 26. Eurythenes gryllus (Lichtenstein in Mandt, 1822), presumably female, 50 mm, RV Jan Mayen, 82 ° 26 ' N 20 ° 52 ' E, 1660 m, RBINS, INV. 122783. A, left Ep 1; B, left Ep 2; C, left Ep 3; D, right U 1; E, right U 2; F, right U 3 (dorsal side); G, right U 3 (ventral side); H, telson.