Anacharis ensifer Walker, 1835
publication ID |
https://doi.org/10.3897/jhr.97.131350 |
publication LSID |
lsid:zoobank.org:pub:EA190992-B01B-4F1B-A362-A4549C725580 |
DOI |
https://doi.org/10.5281/zenodo.13538469 |
persistent identifier |
https://treatment.plazi.org/id/87C2E7EE-D237-5729-982F-5A8183FFC229 |
treatment provided by |
|
scientific name |
Anacharis ensifer Walker, 1835 |
status |
stat. nov. |
Anacharis ensifer Walker, 1835 stat. rev.
Figs 2 A View Figure 2 , 3 A View Figure 3 , 9 A – E View Figure 9
Anacharis ensifer Walker, 1835: 522 - lectotype ( NHMUK) ♀, photographs examined.
Megapelmus rufiventris Hartig, 1841: 358 (removed from synonymy with A. immunis ) - lectotype ( ZSM) ♀, photographs examined.
Diagnosis
(n = 13). Belongs to the immunis species group. Similar to A. norvegica in generally having a largely sculptured mesoscutellum (largely smooth in A. immunis ) (Fig. 9 D View Figure 9 ). Different from A. norvegica by having its mesoscutellum covered with reticulate-foveate sculpture resulting in larger foveae (smaller foveae on mesoscutellum in A. norvegica ) (Fig. 9 D View Figure 9 ). The circumscutellar carina is distinct and usually flanged upwards and appears in lateral view like a posterodorsal tooth (circumscutellar carina not flanged and less distinct in A. norvegica , not appearing like a tooth) (Fig. 9 B View Figure 9 ). The mesopleural line is dorsally well-defined in its anterior half (dorsal margin in anterior half diffused by rugose sculpture of mesopleuron in A. norvegica ) (Fig. 9 B View Figure 9 ). The mesoscutum lacks, or has just a few, wrinkles and has no distinct anteroadmedian signa (in A. norvegica , wrinkles on mesoscutum strong, amplifying the visibility of anteroadmedian signa) (Fig. 9 D View Figure 9 ).
CO 1 barcode.
n = 12. Maximum intraspecific distance = 0.5 %. Minimum distance to closest species ( A. immunis ) = 7.8 %. CO 1 barcode consensus sequence:
AATTTTATACTTTATTTTAGGAATCTGGTCAGCAATATTAGGATCAAGACTTAGTATAATTATTCGAAT AGAATTAGGCACCCCATCTCAATTAATCAGAAATGACCAAATTTACAATTCAATTGTAACAGCTCATGCA TTTATTATAATTTTTTTTATAGTTATACCTATTATAGTCGGAGGATTTGGAAATTACCTAATTCCATTAA TACTCCTATCCCCAGATATAGCTTTCCCACGATTAAATAATATAAGATTTTGATTTCTAATCCCCTCTTT AATTTTAATAGCTTCAAGATTATTTATTGATCAAGGAGCAGGAACCGGATGAACAGTATATCCCCCTTTA TCTTCATTAACAGGTCACTCAGGGATTGCAGTAGACATAACAATTTACTCTCTTCATTTAAGAGGAATTT CTTCAATTTTAGGCTCAATTAATTTTATTAGAACAATTTTAAATATACGAATCAATAAAGTATCAATAGA TAAAATTACCCTATTTACATGATCAATTTTTTTAACTACAATTCTATTACTTTTATCATTACCCGTCCTA GCAGGAGGGATCACTATACTTTTATTTGACCGAAACTTAAATACCTCCTTTTTCGATCCCATAGGAGGAG GAGACCCAATTTTATATCAACATTTATTT
Type material.
Lectotype of Anacharis ensifer Walker, 1835 , designated by Fergusson (1986)
F Walker Coll. 81–86
LECTO-TYPE
B. M. 1981. Under A. ensifer
LECTOTYPE of A. ensifer Walker det. N. D. M. Fergusson, 1981
B. M. TYPE HYM 7. 161
[QR-code] NHMUK 010640456
[for images, see https://data.nhm.ac.uk/dataset/56e711e6-c847-4f99-915a-6894bb5c5dea/resource/05ff2255-c38a-40c9-b657-4ccb55ab2feb/record/10638964]
Lectotype of Anacharis rufiventris Hartig, 1841 , designated by Fergusson (1986)
LECTO-TYPE
Megapelmus n. sp.? [handwritten, probably by Hartig himself]
rufiventris . [handwritten, probably by Hartig himself]
LECTOTYPE of Megapelmus rufiventris Hartig det. N. D. M. Fergusson 1982
Anacharis immunis det. N. D. M. Fergusson 1982
Other material examined.
DNA barcode vouchers. Belgium • 1 ♀; West Flanders, Ypres, De Triangel , Urban park (bushes); 50.8418 ° N, 2.8838 ° E; ca 20 m a. s. l.; 2–23 Jul. 2022; Verheyde, Fons leg.; Malaise trap; ZFMK -TIS-2640867 GoogleMaps .
Norway • 2 ♂♂; Rogaland Ytre, Sola, Indraberget ; 58.9124 ° N, 5.6628 ° E; ca 20 m a. s. l.; 24 Aug. - 6 Sep. 2020; Leendertse, Arjen leg.; Malaise trap; ZFMK -TIS-2629222 , ZFMK -TIS-2629223 GoogleMaps . • 1 ♂; same collection data as for preceding; 20 Sep. - 5 Oct. 2020; ZFMK -TIS-2629221 GoogleMaps . • 1 ♀, 3 ♂♂; Rogaland Ytre, Stavanger, Byhaugen ; 58.9731 ° N, 5.6988 ° E; ca 50 m a. s. l.; 6–29 Aug. 2020; Birkeland, Jarl leg.; Malaise trap; female - ZFMK -TIS-2629272 ; males - ZFMK -TIS-2629209 , ZFMK -TIS-2629210 , ZFMK -TIS-2629211 GoogleMaps . • 1 ♀; same collection data as for preceding; 25 Sep. - 31 Oct. 2020; ZFMK -TIS-2629249 GoogleMaps . • 3 ♂♂; Rogaland Ytre, Time, Mossige ; 58.69 ° N, 5.7239 ° E; ca 60 m a. s. l.; 17 Sep. - 11 Oct. 2020; Mjøs, Alf Tore leg.; Malaise trap; ZFMK -TIS-2629206 , ZFMK -TIS-2629207 , ZFMK -TIS-2629208 GoogleMaps .
Material without DNA barcode. Belgium • 3 ♂♂; Walloon Brabant, Ottignies ; 16–23 Jul. 1983; Paul Dessart leg.; Malaise trap; JV_Prel_0047 ( RBINS), JV_Prel_0048 ( RBINS), JV_Prel_0049 ( RBINS) . • 1 ♀; West Flanders, Ypres, De Triangel , Urban park (pool vegetation); 50.8427 ° N, 2.884 ° E; ca 20 m a. s. l.; 18 Jun. - 2 Jul. 2022; Fons Verheyde leg.; Malaise trap; ZFMK -TIS-2640864 GoogleMaps .
Denmark • 1 ♂; Eastern Jutland, Alminde hule , 20 km S of Vejle; 30 May 1982; Torkhild Munk leg.; NHRS - HEVA 000023120 View Materials ( NHRS) . • 1 ♂; Eastern Jutland, Klattrup, 10 km S of Velje, Bygade , on compost heap; 28–29 Jul. 1982; Torkhild Munk leg.; NHRS - HEVA 000023118 View Materials ( NHRS) . • 1 ♀; Eastern Jutland, Nørreskov , 10 km E of Kording; 31 Jul. 1984; Torkhild Munk leg.; NHRS - HEVA 000023119 View Materials ( NHRS) .
Germany • 2 ♀♀; Bavaria, near Schwandorf ; 49.3042 ° N, 12.1184 ° E; ca 360 m a. s. l.; Ernst Klimsa leg.; specimen in coll MF GoogleMaps . • 1 ♂; Brandenburg, Potsdam-Mittelmark, Kleinmachnow ; 22 Jun. 1925; S. Bollow leg.; JV_Prel_0042 ( SDEI) . • 1 ♀; North Rhine-Westphalia, Rhein-Sieg-Kreis, Schladern near Windeck, Sieg river , right river bank; 50.8 ° N, 7.585 ° E; ca 130 m a. s. l.; 4–11 Jul. 2017; ZFMK et al. leg.; Malaise trap; ZFMK -TIS-2629278 GoogleMaps .
The Netherlands • 1 ♀; Gelderland, Nijmegen, Gelderse poort ; 23 Aug. 2022; R. Lexmond leg.; Malaise trap; JV_Prel_0050 ( RBINS) .
Norway • 2 ♀♀; Akershus, Baerum, Ostøya ; 10 Jun. - 1 Jul. 1984; Fred Midtgaard leg.; NHRS - HEVA 000023124 View Materials ( NHRS), NHRS - HEVA 000023125 View Materials ( NHRS) . • 1 ♀; Norvegia alpina (“ Nv alp ”); [1832]; Carl Henning Boheman leg.; NHRS - HEVA 000023123 View Materials ( NHRS) . • 2 ♀♀; Rogaland Ytre, Stavanger, Byhaugen ; 58.9731 ° N, 5.6988 ° E; ca 50 m a. s. l.; 6–29 Aug. 2020; Jarl Birkeland leg.; Malaise trap; ZFMK -TIS-2629273 , ZFMK -TIS-2629274 GoogleMaps . • 1 ♂; same collection data as for preceding 25 Sep. - 31 Oct. 2020; ZFMK -TIS-2629205 GoogleMaps .
Sweden • 1 ♀; Gotska sandön, Lilla lövskogen ; 6 Aug. 1952; Anton Jansson leg.; NHRS - HEVA 000023126 View Materials ( NHRS) . • 3 ♂♂; Öland, Ås, Ottenbylund , glade in deciduous grove; 56.2194 ° N, 16.4224 ° E; ca 10 m a. s. l.; 24 Jul. - 1 Aug. 2003; Swedish Malaise Trap Project (Swedish Museum of Natural History) leg.; Malaise trap; NHRS - HEVA 000023139 View Materials ( NHRS), NHRS - HEVA 000023140 View Materials ( NHRS), NHRS - HEVA 000023141 View Materials ( NHRS) GoogleMaps . • 1 ♂; Öland, Kastlösa ; 26 Jun. 1952; Karl-Johan Hedqvist leg.; NHRS - HEVA 000023138 View Materials ( NHRS) . • 1 ♂; Öland, Torslunda, Gamla skogsby , Diversitetsängen , rich transitional meadow with shrubs near nemoral forest; 56.6167 ° N, 16.5076 ° E; ca 40 m a. s. l.; 17 Jul. - 7 Aug. 2003; Swedish Malaise Trap Project (Swedish Museum of Natural History) leg.; Malaise trap; NHRS - HEVA 000023142 View Materials ( NHRS) GoogleMaps . • 2 ♂♂; Östergötland, Omberg, Stocklycke , meadow in Tilia-dominated forest; 58.3075 ° N, 14.631 ° E; ca 130 m a. s. l.; 22 Jul. - 5 Aug. 2003; Swedish Malaise Trap Project (Swedish Museum of Natural History) leg.; Malaise trap; NHRS - HEVA 000023143 View Materials ( NHRS), NHRS - HEVA 000023144 View Materials ( NHRS) GoogleMaps . • 3 ♀♀, 1 ♂; Småland ; [18 xx]; Carl Henning Boheman leg.; females - NHRS - HEVA 000023127 View Materials ( NHRS), NHRS - HEVA 000023128 View Materials ( NHRS), NHRS - HEVA 000023129 View Materials ( NHRS); male - NHRS - HEVA 000023130 View Materials ( NHRS) . • 1 ♀, 1 ♂; Södermanland, Ludgo s: n, Tovetorp fieldstation ; 58.9478 ° N, 17.1485 ° E; ca 50 m a. s. l.; 6 Aug. 2012; Mattias Forshage leg.; sweep net; female - NHRS - HEVA 000023131 View Materials ( NHRS); male - NHRS - HEVA 000023132 View Materials ( NHRS) GoogleMaps . • 1 ♀; Södermanland, Trosa kommun, Hunga södergård 1, agricultural backyard, heavily eutrophicated, in tall grass near stable manure pile; 58.9207 ° N, 17.5212 ° E; ca 20 m a. s. l.; 9–19 Aug. 2004; Swedish Malaise Trap Project (Swedish Museum of Natural History) leg.; Malaise trap; NHRS - HEVA 000023133 View Materials ( NHRS) GoogleMaps . • 1 ♀; Uppland, Håbo kommun, Biskops-Arnö , northern beach, elm grove; 59.6721 ° N, 17.5009 ° E; ca 10 m a. s. l.; 20 May- 20 Jun. 2005; Swedish Malaise Trap Project (Swedish Museum of Natural History) leg.; Malaise trap; NHRS - HEVA 000023136 View Materials ( NHRS) GoogleMaps . • 1 ♀; Uppland, Uppsala kommun, Ekdalen , herb-rich open oak forest; 59.9715 ° N, 18.355 ° E; ca 40 m a. s. l.; 21 Jul. - 4 Aug. 2003; Swedish Malaise Trap Project (Swedish Museum of Natural History) leg.; Malaise trap; NHRS - HEVA 000023135 View Materials ( NHRS) GoogleMaps . • 1 ♀; same collection data as for preceding 23 Aug. - 6 Sep. 2004; NHRS - HEVA 000023134 View Materials ( NHRS) GoogleMaps . • 1 ♂; Uppland, Vallentuna , forest; 19 Jul. 1959; Karl-Johan Hedqvist leg.; sweep net; NHRS - HEVA 000023137 View Materials ( NHRS) .
Switzerland • 1 ♀; Genève, La Louton ; 12 Aug. 1960; André Comellini leg.; specimen at MHNG . • 1 ♀; Neuchâtel, Auvernier ; 2 Aug. 1960; Jacques de Beaumont leg.; specimen at MHNG . • 1 ♀; same collection data as for preceding 5 Aug. 1959; specimen at MHNG . • 1 ♂; same collection data as for preceding 8 Aug. 1957; specimen at MHNG . • 1 ♂; same collection data as for preceding 18 Aug. 1986; specimen at MHNG . • 1 ♀; same collection data as for preceding 26 Aug. 1956; specimen at MHNG . • 1 ♀; same collection data as for preceding 28 Aug. 1956; specimen at MHNG . • 1 ♂; same collection data as for preceding 31 Aug. 1956; specimen at MHNG . • 1 ♂; Vaud, Bussigny ; 26 Jul. 1958; Jacques de Beaumont leg.; specimen at MHNG . • 1 ♂; Vaud, Lutry Aug. 1956; Jacques Aubert leg.; specimen at MHNG . • 1 ♀; Vaud, Pampigny ; 19 Jun. 1960; Jacques de Beaumont leg.; specimen at MHNG .
Biology.
Summer species, flying mainly from May to October, peak in August. Collected mainly in deciduous forest and in open nemoral habitats.
Distribution.
Verified by morphological examination: Belgium, Denmark, Germany, The Netherlands, Norway, Sweden, Switzerland, United Kingdom (locus typicus : England, near London or Windsor forest).
No DNA barcode matches with publicly available sequences from other countries.
Lowland species, occurring in elevations below 400 m a. s. l.
Remarks.
We remove A. ensifer from the synonymy with A. immunis that was established by Fergusson (1986).
Walker’s original name Anacharis ensifer was changed into A. ensifera by Reinhard (1860). While Thomson (1862) maintained ‘ ensifer ’, most authors from Cameron (1890) on followed Reinhard’s emendation. However, ‘ ensifer ’ can be a noun as well as an adjective (and Walker’s intentions are not clear in the description), but Reinhard’s emendation for gender agreement purposes makes sense only if it is an adjective. § 31.2. 2 in the zoological code ( ICZN 1999) clearly states that in such ambiguous cases it is to be treated as a noun, thus the original spelling is retained and the gender ending remains unchanged.
Almost all specimens of A. ensifer show an intermediate stage of sculpturing of the mesoscutellum between A. immunis (largely smooth) and A. norvegica Mata-Casanova & Pujade-Villar, 2018 (finely foveate on both dorsal and posterior surface of the mesoscutellum), with the exception of ZFMK -TIS-2629272 , which has a largely smooth mesoscutellum like in A. immunis but clusters within A. ensifer by its CO 1 barcode sequence.
Anacharis ensifer falls within the diagnosis of A. immunis in Mata-Casanova et al. (2018) and thus the two host records and all distributional data given therein must be re-evaluated considering the existence of two species behind A. immunis sensu Mata-Casanova et al. (2018) .
Works prior to Fergusson (1986) describe A. ensifer largely based on colouration, but always state a smooth mesoscutellum (e. g. Reinhard 1860 & von Dalla-Torre and Kieffer 1910), which is not in line with our findings. Historical literature records therefore require critical evaluation, too.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
SuperFamily |
Cynipoidea |
Family |
|
Genus |
Anacharis ensifer Walker, 1835
Vogel, Jonathan, Forshage, Mattias, Bartsch, Saskia B., Ankermann, Anne, Mayer, Christoph, von Falkenhausen, Pia, Rduch, Vera, Müller, Björn, Braun, Christoph, Krammer, Hans-Joachim & Peters, Ralph S. 2024 |
Anacharis ensifer
Walker F 1835: 522 |
Megapelmus rufiventris
Megapelmus rufiventris Hartig, 1841: 358 |