Mastigodiaptomus cuneatus, Gutierrez-Aguirre, Martha Angelica & Cervantes-Martinez, Adrian, 2016

Gutierrez-Aguirre, Martha Angelica & Cervantes-Martinez, Adrian, 2016, A new species of Mastigodiaptomus Light, 1939 from Mexico, with notes of species diversity of the genus (Copepoda, Calanoida, Diaptomidae), ZooKeys 637, pp. 61-79 : 63-70

Mastigodiaptomus cuneatus sp. n. Figures 1, 2, 3, 4, 5

Holotype.

One adult female dissected on one slide: ECOCH-Z-09339. Collected 28.VIII.2014. Collectors: A. Cervantes-Martinez, N. Hernández López, M. Bastidas, and J. Aguilar Rubio.

Allotype.

One adult male dissected on one slide: ECOCH-Z-09340. Collected 28.VIII.2014. Same collectors.

Paratypes.

Four adult females and five adult males preserved in 90% ethanol with a drop of glycerine. ECOCH-Z-09341. Collected 28.VIII.2014. Same collectors.

Two adult females and two adult males preserved in 90% ethanol: CNCR-31861. Collected 28.VIII.2014. Same collectors.

Type locality.

A lagoon called Laguna El Camarón in Avenida Insurgentes, Mazatlán, Sinaloa City, México; 23°14'10"N; 106°26'18"W.

Etymology.

The name of the species means “wedged” in Latin and refers to the chitinous protuberance present on the right disto-lateral corner of the first and second urosomites in females, and on the right caudal ramus on the ventral surface in males.

Diagnosis.

Adult female: Cuticle surfaces of prosomal somites smooth dorsal and laterally (Fig. 1A, B). Antennules tip reaching beyond the caudal rami. Right wing of fifth pediger with one tiny dorsal spinule plus one stout ventral spine; left wing with two spines (Fig. 1A, D). No dorsal process on the last thoracic somite (Fig. 1B). Genital double-somite and second urosomite with one lateral wedge each on distal margin on the right side (Fig. 1D). Genital double-somite asymmetric and laterally bulbose; each bulb bearing a stout lateral spine (Fig. 1D). Short spines on the rostrum, which are less than 3 times longer than wide (Fig. 2A, B). Endopodite of fifth leg 2-segmented with a row of short spinules (arranged in one oblique line) flanked by 2 larger spinules; Exp3 of the fifth leg bearing 2 apical spines (Fig. 2G).

Adult male: The cuticle surfaces of prosomal somites are smooth dorsally and laterally (Fig. 1C). Right antennule 22-segmented, with one fang-like process on antepenultimate segment, which is less than half the length of the penultimate segment (Fig. 4D). Right antennule with spiniform process on segments 10, 11, and 13 to 16 (Fig. 4D). Inner margin of caudal ramus fringed by long hair-like setae (Fig. 1C). One wedge on distal margin of right caudal ramus on the ventral surface (Fig. 4E). Left and right coxae of the fifth leg have long, acute spines on lateral margins; apical spine of right Exp2 with tiny spinules along medial margin (Fig. 5D). One triangular and one rounded projection located at distal and proximal margins of the right basis, respectively, plus one hyaline membrane on caudal side (Fig. 5D). The aculeus length is almost the width of right Exp2. Left and right endopods one-segmented, with apical spinules (Fig. 5C).

Description adult female.

Smooth prosomal somites; body length 1500-1700 µm in paratypes including caudal ramus, n = 6 (Fig. 1A, B). Spines on rostrum 2.8-3.0 times longer than wide (Fig. 2B).

Antennule: 25-segmented, extending beyond the caudal ramus (Fig. 1A). Armature details with setae, spines, or aesthetasc in the next order: (1)1s + 1ae; (2)3s+1ae; (3)1s+1ae; (4)1s; (5)1s + 1 ae; (6)1s; (7)1s+1ae; (8)1s +1 sp; (9)2s + 1ae; (10)1s; (11)1s+1ae; (12)1s + 1ae + 1sp; (13)1s; (14)1s+1ae; (15)1s; (16)1s+1ae; (17)1s; (18)1s; (19)1s+1ae; (20)1s; (21)1s; (22)1s + 1ae; (23)1s + 1ae; (24)2s; (25)4s + 1ae.

Antenna: Coxa with one long seta; basis with 2 setae; Exp 7-segmented with 1, 3, 1, 1, 1, 1, 4 setae, respectively. Enp 2-segmented, Enp1 with 2 setae plus a row of spine-like setae. Inner lobe of Enp2 bearing 9 long setae, outer lobe with 7 setae and a group of tiny spinules (Fig. 3A).

Mandible: Eight teeth on gnathobase (6 of these teeth bifid) with a movable seta at tip. Rectangular, nude coxa. Basis with 4 long setae. Enp two-segmented, Enp1 with 4 setae, Enp2 with 2 distal pectens and 9 long setae. Exp 4-segmented, with 1, 1, 1, and 3 long setae, respectively (Fig. 3B).

Maxillule (Fig. 3C): Coxal epipodite elliptical, bearing 9 long setae. Short basal exite, one-setulated; Exp plate-like with 6 long setae. Enlarged basal endite with 4 setae and 2-segmented endopodite: Enp1 and Enp2 with 5 and 4 setae, respectively. Basis rectangular with 4 setae; coxal endite quadrangular 4-setulated. Praecoxal arthrite with 15 spiniform setae, 11 anterior, 4 posterior.

Maxilla (Fig. 3D): First praecoxal lobe with 4 long setae and 1 lateral short seta; plus long setules and 1 spinule on posterior side. Second praecoxal lobe 3-setulated. Two coxal lobes with 3 long setae each. All the praecoxal and coxal lobes with long setules located posteriorly. First basal lobe with 4 setae, second basal lobe with 1 seta. Three-segmented Enp, with 1, 1, and 3 setae, respectively.

Maxilliped (not figured): Same structure as described and illustrated for Mastigodiaptomus albuquerquensis and Mastigodiaptomus patzcuarensis (see Gutiérrez-Aguirre et al. 2014).

P1-P4: The number of segments on endopods and exopods of P1 to P4, as described for copepods that belong to the Diaptomidae family ( Dussart and Defaye 1995). Armature formula of swimming legs as shown in Table 2 including Schmeil’s organ on Enp2P2.

Fifth pediger wings and urosome: Right wing of fifth pediger with 2 spines, one dorsal and one ventral (Fig. 2C), left wing with 2 equal spines (Fig. 2D). Genital double-somite and second urosomite each with projections at right distal corner (Fig. 2C); these projections wedge-like in dorsal (Fig. 1D) and ventral views (Fig. 2E). Genital double-somite 1.2 ± 0.1 times longer than wide, lateral margins bulbous and with strong spines; right spine inserted laterally, more proximal than left spine (Fig. 2E). Caudal ramus with long hair-like setules on medial and lateral margins (Fig. 2E). Genital field quadrangular with parallel lateral margins (Fig. 2F).

Fifth leg (Fig. 2G): Coxa with a large spine on distal margin, basis quadrangular with a blunt projection on distal margin and one slender lateral seta. Exp1 1.66 times longer than 2-segmented endopod. Second endopodal segment with a row of spinules at the tip arranged in an oblique line, flanked by 2 larger spinules. Exp2 separated, with one long and one short spine. Exp3 with spinules on distal medial and lateral margins.

Description adult male.

Prosomites smooth in dorsal view; left antennule reaching anal somite. Body length 1400-1500 µm in paratypes including caudal ramus, n = 7 (Fig. 1C). Short spines on rostrum 2.7-2.8 times longer than wide (Fig. 4A).

Right antennule (Fig. 4D): 22-segmented, each segment armed with setae, spines, spiniform process, or aesthetasc in the following order: (1)1s+1ae; (2)2s+2ae; (3)1s+1ae; (4)1s; (5)1s+1ae; (6)1s; (7)1s+1ae; (8)1s+1sp; (9)2s+1ae; (10)1s+1sps, (11)1s+1sps; (12)1s+1ae+1sp; (13)1s+1ae+1sps; (14)2s +1ae+1sps; (15)2s +1ae+1sps; (16)2s+ 1ae+1sps; (17)1s+1sp; (18)1s+1sp; (19)1s+1ae; (20)4s; (21)2s; (22)3s+1ae. Segments 17-19 with acuted lamellae on inner margins.

Spiniform process on segment 10 very short, reaching only distal third of its segment; that on segment 11 short, reaching proximal third of the next segment. Convergent spiniform processes on segments 13 and 14. Base of stout spiniform process on segment 13 almost as wide as the length of its segment. Segment 20 is 3.6 times as long as wide, bearing a hook-like projection (less than the half length of penultimate segment) with a smooth hyaline membrane.

Antennule, antenna, mandible, maxillule, maxilla, maxilliped, and P1-P4 as described for female.

Right wing of fifth pediger with 1 tiny dorsal spinule and 1 ventral spine (Fig. 4B); left wing bearing 1 small spine (Fig. 4C).

Urosome: Urosomites nude dorsally and ventrally. First urosomite with thin spine on right side and fold on left side (Fig. 4E). Fourth urosomite slightly projected on right side. Right caudal ramus with wedge-like structure at disto-inner corner of ventral surface; medial margins of rami pilose (Figs 4E, 5A, B).

P 5: Coxal segments with strong spines on caudal view; left and right basis with a lateral seta (Fig. 5D).

Left basis with a triangular protuberance on distal margin of frontal surface (Fig. 5C). Both left Exp1 and Exp2 pilose on medial margins (Fig. 5F), left Exp2 triangular, with its tip adorned with a small inner seta and spinules (Fig. 5F). Left Enp 1-segmented, distally feathered and as long as left Exp1 (Fig. 5C).

Right basis basally and distally projected: basal projection rounded whereas distal projection triangle-shaped; one semi-triangular sclerotization on caudal surface of right basis (Fig. 5D, E). Right Exp1 quadrangular in frontal view (Fig. 5C), one triangular fold and one rounded projection on caudal view (Fig. 5D). Right Exp2 1.6-1.8 times longer than wide and 1.9-2.0 times longer than aculeus, smooth in both frontal and caudal views (Fig. 5C, D). Aculeus inserted at distal third of the segment, pointed, unarmed, short (no longer than the width of the right Exp2). Terminal claw twice the length of Exp2 smoothly bent and ornamented with tiny spinules on inner margin (Fig. 5D). Right Enp one-segmented slightly longer than right Exp1 (Fig. 5C).

Molecular features.

The nucleotide sequence (607 bp) obtained for specimen MAGA-0156 (one adult male), identified as Mastigodiaptomus cuneatus sp. n. is shown below:

GGAGCCTGGTCAGGCATAGTAGGAACAGGCCTTAGAATGATTATTCGGATGGAGTTAGGACAAGCCGGGTCTTTAATTGGAGATGACCAAATTTATAATGTAGTAGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATGGTGATACCTATTTTAATTGGGGGGTTTGGTAATTGGCTTGTTCCGTTAATATTAGGTGCAGCGGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTTTTATTGCCAGCTTTAGTCATATTGTTATCTAGGTCGCTTGTTGAAAGAGGGGCGGGAACAGGGTGAACTGTGTATCCCCCCCTGTCTAGCAACATTGCCCATGCTGGCAGGTCCGTTGATTTTGCTATTTTTTCGCTTCATTTAGCTGGGGTTAGGTCTATTTTGGGCGCAGTAAATTTTATTAGCACATTAGGAAATTTGCGGGCGTTTGGAATAATTTTAGATCGAATACCACTTTTTGCTTGAGCCGTTTTAATCACGGCTATCTTGTTATTGCTTTCTCTTCCTGTTTTAGCCGGGGCGATTACAATGCTTCTTACAGATCGGAACCTCAACTCAAGATTTTATGAT.

The K2P maximum distance between the surveyed species reaching 5.52% (Table 3). The nearest neighbour of Mastigodiaptomus cuneatus sp. n. is Mastigodiaptomus albuquerquensis with 18.64% of genetic distance (Fig. 6).