Clavicornaltica mataikanensis Otani, Bertoli, Lucchini, Boin, Ellis, Friedrich, Jacquot, Kountouras, Lim, Nigro, Otani, Syafi'ie , Tan, Grafe, Cicuzza, Njunjic & Schilthuizen, 2024

Otani, Sean, Bertoli, Luca, Lucchini, Filippo, van den Beuken, Tom P. G., Boin, Desanne, Ellis, Lehman, Friedrich, Holm, Jacquot, Brittany, Kountouras, Sotiris, Lim, Sarah Yu Rou, Nigro, Eleonora, Su'eif, Syafi'ie, Tan, Wei Harn, Grafe, Ulmar, Cicuzza, Daniele, Delledonne, Massimo, Njunjic, Iva & Schilthuizen, Menno, 2024, A new, unusually large, Clavicornaltica Scherer, 1974 flea beetle from Borneo, described and sequenced in the field by citizen scientists (Coleoptera, Chrysomelidae, Galerucinae), Biodiversity Data Journal 12, pp. 119481-119481 : 119481

Clavicornaltica mataikanensis Otani, Bertoli, Lucchini, Boin, Ellis, Friedrich, Jacquot, Kountouras, Lim, Nigro, Otani, Syafi'ie, Tan, Grafe, Cicuzza, Njunjic & Schilthuizen sp. nov.

Clavicornaltica Scherer, 1974 - Scherer (1974), Medvedev (1996), Konstantinov and Duckett (2005). Type species: Clavicornaltica besucheti Scherer, 1974

Materials

Type status: Holotype. Occurrence: catalogNumber: UBDM.3.06346 ; recordedBy: Taxon Expeditions field course participants; individualCount: 1; sex: female; lifeStage: adult; preparations: whole animal (dry), card-mounted; disposition: in collection; occurrenceID: B64B1B95-6CD9-5C93-B1E2-329FF04F617A; Taxon : kingdom: Animalia ; phylum: Arthropoda ; class: Insecta ; order: Coleoptera ; family: Chrysomelidae ; genus: Clavicornaltica ; specificEpithet: mataikanensis; taxonRank: species; scientificNameAuthorship: Otani et al. 2024; nomenclaturalCode: ICZN; Location : continent: Asia ; island: Borneo ; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre ; verbatimLocality: Ulu Temburong, near Kuala Belalong Field Studies Centre , along Mata Ikan stream; verbatimElevation: 60 m; decimalLatitude: 4.5491; decimalLongitude: 115.1561; Event : samplingProtocol: Winkler eclector; samplingEffort: 250 l of leaf litter; eventDate: 16-09-2023; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence: catalogNumber: UBDM.3.06347 ; recordedBy: Taxon Expeditions field course participants; individualCount: 1; sex: female; lifeStage: adult; preparations: whole animal (dry), card-mounted; disposition: in collection; occurrenceID: A1593B82-F1B3-5B88-B486-6B82F4A38EDC; Taxon : kingdom: Animalia ; phylum: Arthropoda ; class: Insecta ; order: Coleoptera ; family: Chrysomelidae ; genus: Clavicornaltica ; specificEpithet: mataikanensis; taxonRank: species; scientificNameAuthorship: Otani et al. 2024; nomenclaturalCode: ICZN; Location : continent: Asia ; island: Borneo ; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre ; verbatimLocality: Ulu Temburong, near Kuala Belalong Field Studies Centre , along Mata Ikan stream; verbatimElevation: 60 m; decimalLatitude: 4.5491; decimalLongitude: 115.1561; Event : samplingProtocol: Winkler eclector; samplingEffort: 250 l of leaf litter; eventDate: 16-09-2023; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence: catalogNumber: TXEX.COL.01545 ; recordedBy: Taxon Expeditions field course participants; individualCount: 1; sex: female; lifeStage: adult; preparations: whole animal (dry), card-mounted; disposition: in collection; occurrenceID: 16312EBB-D6F5-5F0D-98E4-C2F72E357A86; Taxon : kingdom: Animalia ; phylum: Arthropoda ; class: Insecta ; order: Coleoptera ; family: Chrysomelidae ; genus: Clavicornaltica ; specificEpithet: mataikanensis; taxonRank: species; scientificNameAuthorship: Otani et al. 2024; nomenclaturalCode: ICZN; Location : continent: Asia ; island: Borneo ; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre ; verbatimLocality: Ulu Temburong, near Kuala Belalong Field Studies Centre , along Mata Ikan stream; verbatimElevation: 60 m; decimalLatitude: 4.5491; decimalLongitude: 115.1561; Event : samplingProtocol: Winkler eclector; samplingEffort: 250 l of leaf litter; eventDate: 20-09-2023; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; institutionID: TXEX; institutionCode: TXEX; basisOfRecord: PreservedSpecimen

Description

Habitus. Body dark reddish-brown, large, length ca. 2.0 mm, width ca. 1.8 mm, ovoid and convex, nearly hemispherical. Antennae and visible parts of legs yellowish-brown when viewed dorsally. Head slightly lighter than pronotum and elytra.

Head. Rectangular, moderately covered in light punctures. Antennae capitate; clava ca. 0.3 mm, posterior surface straight, uncurved; anterior surface convexly curved; clava segment 1 as long as wide, segments 2-4 slightly wider than long, segment 5 longer than wide. Eyes convex, ca. 1/7 the width of the head measured across the eyes in dorsal view, each eye consisting of 30-40 ommatidia.

Pronotum. Posterior width ca. 1.1 mm when viewed from above; shiny, slightly duller than the elytra; marginal groove running from the anterior ventral region to ca. 3/5 of the height of the posterior margin, widening posteriorly before narrowing and terminating. Medium to thick scattering of shallow punctures across entire surface. A large setiferous pore ca. 3/4 down the length of the lateral margin with a seta ca. 1.3 times the length of the antennal clava.

Elytra. Striae somewhat irregular, the puctures of the lateral striae deepest, becoming very shallow and indistinct on the more dorsal striae. A narrow groove runs along the dorsal side of the lateral margin of the elytra, deepest anterior, dissipating towards the apex.

Hind wings. Absent.

Abdomen. Majority of abdominal surfaces the same colour as the dorsum, in some parts slightly lighter, pygidium lighter. Upper inside-margin of second abdominal sternite with a series of deep punctures and an acutely raised carina in the shape of an inverted ‘Y’.

Spermatheca. Receptacle 0.29 mm long, J-shaped, fairly uniform in width, slightly thinner towards the top; pump indistinct from receptacle; duct uniform in width and U-shaped where it is attached at the top of the receptacle, ca. ¼ the width of the receptacle, then becoming thinner, entire duct ca. ¾ the length of the receptacle, a bulbous attachment at the terminus of the U-shaped section at the point at which the duct becomes thinner. There is some intraspecific variability visible between the two spermathecae that we dissected (Fig. 4 ): the spermatheca of the paratype is terminally more slender and curved in the holotype than in the paratype.

Male genitalia. Unknown

Diagnosis

Body dark reddish-brown, large, length ca. 2.0 mm, width ca. 1.8 mm, ovoid and convex, nearly hemispherical. Antennae and visible parts of legs yellowish-brown when viewed dorsally. Head slightly lighter than pronotum and elytra. Eyes ca. 1/7 the width of the head in dorsal view. Scutellum small, triangular. Elytra with punctate rows, deeper laterally becoming shallower dorsally (Figs 2 , 3 ). Spermatheca of characteristic shape (Fig. 4 ). Male unknown.

DNA barcode of holotype (BOLD ID: TXEX079-24)

5'GACTTTCCCTTAGTATATTAATCCGAATCGAATTAAGAAATCCAAGATCATTTATTTCTAATATTCATTTATATAATGTTTTAGTAACAATACATGCTTTTATTATAATTTTTTTTATAATTATACCAATTATAATTGGAGGATTCGGAAATTGATTAATCCCACTAATAATTGGGGCCCCTGATATAGCCTTCCCACGTATAAATAACCTAAGATTCTGATTTTTACCTCCTTCTATAATCTTATTAATTCTTAGTATATTTAGTGAAATAGGAGCAGGAAGAGGATGAACCCTTTATCCCCCATTATCAAATACTTTCTTCCATAATGGACCCGCTATTGACCTAACTATTTTTAGTCTTCATTTAGCTGGAATCTCATCAATCCTTGGAGCAATAAACTTTATTTCTACAATAATTAATATAAAAATTTATAAATTAAAATTTGATCAAATAACCCTCTTTTCTTGAGCTTCCCTTATTACAACTATTCTATTACTATTAGCTTTACCTGTATTAGCAGGAGCTATCACTATACTACTTACAGATCGTAATCTTAATACTTCTTTTTTTGATCCCTCAGGAGGAGGAGACCCCCTATTATAT3'.

Etymology

As is customary on our Taxon Expeditions, the name for the new species was decided during a voting session on the last night of the expedition. The proposal which won the most votes was to name it after the stream that runs through the small ravine where the specimens were found, namely Sungai (stream) Mata Ikan. We therefore decided to name it Clavicornaltica mataikanensis sp. nov. Due to the large number of authors, following Recommendation 51C of the Code ( ICZN 1999), the species can be referred to as Clavicornaltica mataikanensis Otani et al., 2024, provided the full citation of this publication appears in the bibliography or elsewhere in the referring work.

Distribution

Known only from the leaf litter on the banks of a small section of the Mata Ikan Stream (Sungai Mata Ikan), between the upper and lower waterfalls where the Ashton Trail crosses the stream (approximately 100 m upstream from where the Mata Ikan Stream enters the Belalong River).

Ecology

All specimens were collected on the ground, within several metres on either side of the stream. The Mata Ikan Stream flows through a steep ravine shaded by large trees (e.g. Dipterocarpaceae ) with the banks covered in a diversity of saplings, ferns and monocots.

Taxon discussion

Differential comparisons were made with all known species of Clavicornaltica of similar size and in geographical proximity (geographical distances were calculated in distancefromto.net). Clavicornaltica mataikanensis sp. nov. can be distinguished from the syntopic C. belalongensis Schilthuizen et al., 2019 by the former's larger size and strongly different female genitalia: shorter and pear-shaped ( Schilthuizen et al. 2019). Clavicornaltica sabahensis Schilthuizen et al., 2017, at ca. 230 km distance, is geographically the second closest currently known member of this genus; however, it is distincltly smaller, has more regular elytral striae and a distinctly punctured pronotum. Clavicornaltica iriana sarawacensis Medvedev, 1996 is much smaller (length 1.2 - 1.4 mm) ( Medvedev 1996). Clavicornaltica besucheti Scherer, 1974 from Sri Lanka is similar in size (holotype: length 1.5 - 2.2 mm; width 1.37 mm), though, with the variability in many of the morphological characteristics described in Forms A-D ( Scherer 1974), it is likely that C. besucheti , as circumscribed by Scherer (1974), consists of multiple species. It differs from C. mataikanensis sp. nov. in having a punctured pronotum and a keel on the first abdominal sternite that is (judging by Fig. 4 in Scherer (1974)) narrow along its entire length and not broadened posteriorly. Clavicornaltica malayana Medvedev, 1996, from Peninsular Malaysia is similar in size (length 1.9 mm, width 1.25 mm), has a black as opposed to dark reddish-brown body colour, the raised carina on the second abdominal sternite tapers posteriorly to a point rather than an inverted ‘Y’ and is also separated by considerable geographical distance (ca. 1520 km) ( Medvedev 1996). Clavicornaltica buechei Medvedev, 2008, from Central Sulawesi is about 25% shorter (length 1.4 mm), has a dark brown to piceous body colour and is geographically distant (ca. 930 km) ( Medvedev 2008). Clavicornaltica tarsalis Medvedev, 1996 from West Papua is smaller, pitch black rather than dark reddish-brown and is geographically separated by ca. 2150 km as well as elevationally (it was collected at 1900 m elevation; Medvedev (1996)). Clavicornaltica trautneri Medvedev, 1993 from the Philippines is similar in size (length 2.1 mm), but differs in body colour ( Medvedev 1993). Clavicornaltica philippinensis Scherer, 1979, also from the Philippines, is much smaller in size (0.84 - 1.27 mm) ( Scherer 1979) and differs in body colour.

Figures

Figure 2. Clavicornaltica mataikanensis sp. nov., holotype (UBDM. 3.06346), habitus in dorsal (a), lateral (b) and frontal (c) views.

Figure 3. Ventral view (a, photograph; b, drawing) of a paratype of Clavicornaltica mataikanensis sp. nov. (TXEX. COL. 01545).

Figure 4. Spermathecae of Clavicornaltica mataikanensis sp. nov.: On the left, paratype (UBDM. 3.06347), on the right, holotype (UBDM. 3.06346).