Megalothorax potapovi, Schneider, Clement, Porco, David & Deharveng, Louis, 2016

Schneider, Clement, Porco, David & Deharveng, Louis, 2016, Two new Megalothorax species of the minimus group (Collembola, Neelidae), ZooKeys 554, pp. 37-68 : 40-46

Taxon classification Animalia Collembola Neelidae

Megalothorax potapovi sp. n. Figs 1, 2, 3, 4, 5, 6, 7, 13 A–C, 14A, B, 15, 16A

Material examined.

Holotype: male on slide (MNHN-EA040223), Russia: Primorye: south of Posyet: peninsula facing to the town; 130.8034°E, 42.5709°N; alt=30 m; 28.ix.2004; Berlese extraction, forest litter; Louis Deharveng and Anne Bedos leg (RU-120) [MNHN]. Paratypes: 2 males and 5 females on slides (MNHN-EA040224-229), same data as the holotype [MNHN]; 1 specimen (sex unknown) on mount for SEM (MNHN-EA041012), same data as the holotype [MNHN].

Diagnosis.

Whitish in alcohol. Presence of median integumentary protuberance in front of chaeta a0 on forehead. Presence of chaeta X on Ant. IV. Labium: basomedian fields with 3 + 3 chaetae, basolateral fields with 1 + 1 chaetae. Integumentary channels as a paired tree on posterior part of the head, absent on anterior part, connection of channels with linea ventralis circular. Some chaetae enlarged and lanceolate, of which 5 + 5 dorsal, posterior on head and 2 + 2 on Th. II tergum. Inner chaeta of sensory field 2 slender with blunt apex, all inner chaetae of sensory fields 3-6 short flam-shaped. Dorsal abdominal s-chaetae s2 globular, absence of dorsal abdominal s-chaetae s3. Abd. I to V terga with 18 + 18 ordinary chaetae. Each claw of ordinary morphology, subequal. Tenaculum with 3 + 3 teeth. Abd. IV sternum with 2 + 2 chaetae. Mucro lamellae smooth, thin.

Description.

General aspect. Habitus and segmentation typical of the genus (Fig. 1A). Length from labrum to anus: ~380 μm. Specimens whitish in alcohol. Body chaetotaxy sparse including chaetae, s-chaetae, τ-chaetae as trichobothria, neosminthuroid chaetae, wax rod secretory elements and special swollen chaetae within sf2-6. Length of chaetae ranging from microchaetae [5-9 μm] to mesochaetae [10-14 μm] and macrochaetae [15-24 μm]. Shape of chaetae ranging from simple to lanceolate. Greatest chaetae being macrochaetae a4 and a7 on Th. II tergum (24 μm; Fig. 5F, G).

Integument. Secondary granulation made of the usual dorsal rough granules (e.g. Fig. 2A, B) and of smooth and flat irregular discoid granules near the ventral, post-labial chaetae of head. Integumentary channels extending laterally and dorsally in posterior part of head. Those channels as a pair of trees with five terminal branches (Figs 1A, B, 3A, B, 14A). Cephalic channels connection with linea ventralis circular (Figs 3B, 14B). Thoracic channels simple, restricted to ventral part.

Sensory fields and wax rods. A total of 14 + 14 wax rod secretory crypts (2 + 2 on head, 12 + 12 on body), including the ones inserted in each 6 + 6 sensory fields (Figs 3A, 4, 14A, 16A). sf1 without inner chaeta (Figs 1B, 3A). sf2 with one rather slender, curved inner chaeta with blunt apex (Figs 1B, 5E). Each inner chaeta of sf3-6 short, flam-shaped and curved (Figs 2A, B, 5 F–I). sf3 with three inner chaetae (Figs 2A, 5F). sf4 and 5 each with two inner chaetae (Figs 2B, 5G, H). sf6 with one inner chaeta, inner chaeta length: sf6 diameter <0.5 (Fig. 5I). wrc5 adjoining sf5 border (Figs 2B, 5H).

Labrum. Chaetae (Figs 1D, 3E, F): a- and m-row with rather slender mesochaetae, a2 slightly thicker and longer than m0-2; m0-2 apparently smooth, a1, 2 with one external teeth and with inward tip; m0 almost on the same level than m1. Integumentary crests (Figs 1D, 13 A–C): m-row distinctly separated from a-row by the antero-median transversal crest (amt); longitudinal crest ml2 projecting anteriorly, cutting the transversal integumentary crest in two part (amt0, amt2); mt0 distinctly concave; absence of transversal crest posterior to chaetae m2 (pt2); asymmetry present on an least one specimen: ml3 strong and projecting anteriorly on one side, ml3 feeble and not reaching amt2 on the other side. Anterior side of the anterior process with 3 + 3 and one axial integumentary bulge (Fig. 3E). Labrum ridge with two small pikes (Fig. 3E).

Other mouth parts. Oral fold with 2 + 2 mesochaetae. Maxillary outer lobe: palp with subapical mesochaeta and apical papillate macrochaeta, edge of apical papilla with three strong integumentary lobes (Figs 3E, F); sublobal plate with one strong hair (7 μm; Fig. 3E). Basomedian fields of labium with 3 + 3 mesochaetae (Fig. 3B), basolateral fields with 1 + 1 mesochaetae on tubercle. Labial palp chaetal equipment typical of the genus, guard hairs strong in regard of papillate chaetae, hypostomal papillate chaeta flattened laterally in apical part, with subapical enlargement and acuminate apex (Figs 3 G–I). Maxilla as in Figs 5A, B. Mandibula each with five apical teeth, right mandibula with a strong tooth between apex and molar plate (Figs 5C, D).

Head chaetotaxy. Trend for posterior chaetae to be longer and stronger than anterior chaetae, with 5 + 5 remarkable posterior lanceolate macrochaetae (up to 18 μm, Figs 1B, 3A). Dorsal anterior area with 11 pairs of chaetae (10 + 10 mesochaetae, 1 + 1 macrochaetae) and two axial mesochaetae (Figs 3A, 14A); with an axial integumentary protuberance in front of chaeta a0, devoid of secondary granules (Figs 1B, C, 3A); with 2 + 2 indistinct pseudopore-like elements between sf1 and insertion of antenna. Lateral anterior area with 1 + 1 mesochaetae (Figs 3A, 14A). Dorsal posterior area with 11 pairs of chaetae (5 + 5 lanceolate macrochaetae, 6 + 6 thickened mesochaetae, Fig. 3A, 14A). Ventral side with three pairs of post-labial mesochaetae (Fig. 3B, 14B).

Antennal chaetotaxy. Illustrated in Figs 3C, D, pattern diagram in Fig. 15 and summarized in Table 1. Ant. I with one mesochaeta. Ant. II with four chaetae: an anterior mesochaetae and three microchaetae. Ant. III with eight chaetae (four mesochaetae, five microchaetae), two long S-chaetae (S1, S4) and two short S-chaetae (S2, S3) in a cupule. S2 and S3 protruding from a shallow cupule but partially covered by a strong integumentary lobe. S1, S4 ornamentation unclear in light microscopy, S2, S3 ornamentation feebly visible. S4 in apical position to S1, on the same level than S2, S3. Tip of S1 rising up to Ant. IV basal whorl of S-chaetae, tip of S4 rising up to Ant. IV apical whorl of S-chaetae. Ant. IV with twelve S-chaetae (10 S, Sy and Sx), six microchaetae (only three chaetae in subapical group including chaeta X), a small organite (Or), two apical and subapical rods (a, sa). S-chaetae S with blunt apex.

Thoracic terga chaetotaxy. Th. II with 12 + 12 chaetae of variable length, 1 + 1 s-chaetae s1 tubular and curved and 3 + 3 τ-chaetae (Figs 4, 16A). Chaetae including 3 + 3 macrochaetae (length as a4> a7> p8), 7 + 7 mesochaetae (a1-3, p1 and p2 thickened, a8 and a9 slender), 2 + 2 microchaetae (p3, p4) (Figs 4, 5F, G). Chaeta p4 postero-lateral to sf3 (Figs 4, 5F, 16A). Two τ-chaetae in the periphery of sf3, one in posterior position and next to p2, one in lateral position and 10-11 granules far from p4 (Figs 4, 5F, 16A). Th. III with 10 + 10 chaetae, 6 + 6 free wax-rod generating crypts (wrc1-6) and 5 + 5 τ-chaetae (Figs 4, 16A). Chaetae including 2 + 2 macrochaetae (a9, p7), 7 + 7 mesochaetae (a1, a5, a6, a8, p2, p3, p4) and 1 + 1 microchaetae (a3) (Figs 4, 5H, J). Chaeta p4 moved posteriorly from wrc2 (Figs 4, 16A). Chaeta a6 stronger than a5 (Figs 4, 5J).

Legs chaetotaxy. Legs with ordinary chaetae of variable size as in Fig. 6 A–C and summarized in Table 2. Subcoxa 1 I with a mesochaeta, coxa I with a microchaeta. Subcoxa 1, 2 II each with a mesochaeta, coxa II with a macrochaeta. Subcoxa 1, 2 III and coxa III with respectively 2, 1, 1 macrochaetae. Anterior and posterior microchaetae present on each pretarsus.

Claws. Ratio unguis length: pretarsus width on leg I–III respectively as 2.2, 2, 1.73, each claw with ordinary morphology, claw III bulkier than claw I and II (Fig. 6 A–C). Each claw subequal in unguis length and in ratio unguiculus: unguis (~0.5) (Fig. 6 A–C, F). Unguis basal and posterior auxiliary lamellae (la, lp and Bp) well developed, anterior crest (Ba) clear on claw II and III, weaker on claw I (Fig. 6 D–F). Each unguiculus with a well developed posterior crest Cp, anterior crest Ca short and in basal position on claw I and II, more developed and not joining the internal border of the unguiculal lamella on claw III, basal tubercle posterior lobe not or feebly protruding (Figs 6 D–H). Ratio unguis length: tibiotarsus length on leg I–III respectively as 0.54, 0.60, 0.65.

Abd. I–V terga chaetotaxy. With a total of 18 + 18 chaetae, 1 + 1 τ-chaetae, 2 + 2 free wax-rod generating crypts (wrc7, 8), 1 + 1 globular s-chaetae s2 (Figs 4, 16A). Chaetae including 17 + 17 mesochaetae (the longest ε 2, ε 3 and ζ 2 reaching 15 μm) and 1 + 1 macrochaetae (η3, 17-18 μm). Chaeta α 3 close to wrc7, both clearly anterior to β 3 (Figs 4, 16A). Chaetae β 4 and ε 1 missing.

Abd. VI and genital chaetotaxy. Abd. VI: with nine dorsal mesochaetae (Fig. 7A); each anal valve with microchaeta av and several granular crests (Fig. 7A); with 9 + 9 ventral chaetae (Fig. 7A), male with 1 + 1 additional ventral cylindrical swollen chaetae sm (Fig. 7B, C). Genital plate: female with 2 + 2 microchaetae (Fig. 7A); male with 10 + 10 microchaetae (Fig. 7B, C).

Abd. IV sternum and furca. Abd. IV sternum with 2 + 2 neosminthuroid chaetae (Figs 2C, 7A) and 2 + 2 posterior mesochaetae (Fig. 7A). Manubrium with 2 + 2 posterior chaetae. Proximal subsegment of dens with one posterior chaeta (Fig. 7E); distal subsegment posteriorly with two basal spines, one median chaeta and two apical spines, anteriorly with three apical spines, spines without elongated apex (Fig. 7D, E). Mucro with a sharp narrowing in the apical 2/5, lamellae edges smooth (Figs 2D, 7D, E). Ratio dp: dd: mucro = 0.75: 1: 0.88; ratio mucro width: mucro length ~0.16.

Tenaculum and ventral tube. Tenaculum with 3 + 3 hook-like teeth (Fig. 7F). Ventral tube with two apical pairs of mesochaetae (Fig. 7G).

Affinities.

Megalothorax potapovi sp. n. has the characteristics of the minimus group species ( Schneider and D’Haese 2013; Papáč and Kováč 2013). Within this group, it shares with Megalothorax sanctistephani Christian, 1998 a median integumentary structure on forehead but differs from it by the presence of the median chaeta a0, the presence of the chaeta X on Ant. IV, the presence of strong lanceolate macrochaetae on head and thorax and the integumentary channels pattern. The absence of a5 on Ant. III and of abdominal pair of chaetae ε 1 is a similitude with Megalothorax svalbardensis Schneider and D’Haese, 2013 and Megalothorax tatrensis Papáč & Kováč, 2013.

The integumentary structure on forehead and the lanceolate macrochaetae clearly separate Megalothorax potapovi sp. n. from Megalothorax minimus , Megalothorax aquaticus Stach, 1951, Megalothorax svalbardensis , Megalothorax willemi Schneider and D’Haese, 2013, Megalothorax tuberculatus Deharveng and Beruete, 1993, Megalothorax carpaticus Papáč & Kováč, 2013 and Megalothorax tatrensis . Other peculiar characteristics of the species are shape of hypostomal papillate chaeta, presence of a strong lobe protecting S2, S3 on Ant. III, and S4 in apical position on Ant. III. On the basis of labral features Megalothorax minimus (Fig. 13 D–F) differs from Megalothorax potapovi sp. n. (Fig. 13 A–C) by undivided amt, ml2 not joining amt, presence of mt2. A similar asymmetry was observed in both species (ml3 joining amt on one side, not joining amt on the other side). The morphology of the anterior crests (forming the anterior papillae) could not be comprehensively studied.

Ecology and distribution.

The species was collected in lowland forest litter, and only found so far in the southern part of Primorye.

Etymology.

Megalothorax potapovi sp. n. is dedicated to Mikhail Potapov, who led the 2004 field trip in Primorye which allowed to discover the new species.

DNA barcode.

A 658bp fragment of the COI gene was amplified and sequenced from paratype (MNHN-EA040229, voucher 00620C05) and seven other specimens (type locality, specimens lost). 251 bases in 5' were not readable, thus a final sequence of 407bp is available. The sequences are identical. The sequence is deposited into the GenBank database under accession number KR736069. The base composition of the sequence is A = 26%, C = 23.1%, G = 13.5%, T = 37.4% (A + T = 63.4%).

5 ’– TAAGTTTTTGACTTCTTCCACCTTCTCTCACCCTTCTACTTTCAAGAGGTCTAGCAGAATCAGGTGCTGGAACAGGTTGAACTGTTTATCCTCCTTTATCTTCAAATATTTCCCATGCAGGAGCCTCTGTCGACTTAACTATTTTCAGTTTACATTTAGCTGGTATGTCATCAATTTTAGGAGCTATTAATTTTATTACAACTATCTTTAACATACGATCCCCAGGAATAACATGAGATCAAACTTCACTATTTATTTGATCTGTTTTAATTACATCAATTTTACTTCTCTTGTCTCTTCCAGTTCTAGCAGGAGCTATCACCATACTTTTAACCGACCGAAATTTAAATACTTCATTTTTTGACCCCGCTGGGGGTGGTGACCCAATTTTATACCAACACCTATTC–3’