Latouchia wenchuan Hao, Yu & Zhang, 2025

Hao, Long, Yu, Kun & Zhang, Feng, 2025, Description of five new species from southern China, with note on the type species of Latouchia Pocock, 1901 (Araneae, Halonoproctidae), Biodiversity Data Journal 13, pp. e 137852-e 137852 : e137852-

Latouchia wenchuan Hao, Yu & Zhang sp. nov.

Materials

Type status: Holotype. Occurrence: recordedBy: S. Zheng; sex: male; occurrenceID: F52E6726-346A-534A-9BCF-60F1281E11AC; Taxon: scientificName: Latouchia wenchuan sp. nov.; Location: country: China; stateProvince: Sichuan; county: Wenchuan; locality: near Wenchuan Museum ; verbatimElevation: 1377 m; verbatimCoordinates: 31.4706 ° N, 103.5829 ° E; Identification: identifiedBy: L. Hao; Event: eventDate: 27 May 2023; Record Level: institutionCode: MHBU-ARA- 10000055; KYUARA # 1983

Description

Male (Holotype, MHBU-ARA- 10000055). Colouration in ethanol (Fig. 9 A). Carapace yellowish-brown, with eye mound (Fig. 9 C), fovea, chelicerae and outer edge of carapace darker; area between eye mound and fovea with slightly darker colour subtriangular band. Legs colour as carapace. Opisthosoma: Dorsal side grey; ventral side slightly more yellow than dorsal side (Fig. 9 B). Ventral side of whole body generally brighter than dorsal side; sigilla lighter than rest of sternum (Fig. 9 D).

Total length 9.22. Carapace 5.03 long, 4.31 wide; opisthosoma 4.17 long, 2.85 wide. Eye group 0.50 long, 0.45 wide anteriorly, 0.68 wide posteriorly; MOA 0.33 long, front width 0.22, back width 0.38. Eye diameters and interdistance: AME 0.11, ALE 0.25, PME 0.15, PLE 0.19, AME – AME 0.14, AME – ALE 0.12, ALE – PLE 0.13, PME – PME 0.30, PME – PLE 0.07. Palpal coxa 1.51 long, 0.81 wide, bearing 18 / 16 spinules on prolateral-proximal corner. Sternum 3.23 long, 2.46 wide. Labium 0.52 long, 0.87 wide, without cuspule or spinule. Chelicerae without stridulatory ridges; rastellum of left and right chelicerae carrying five and four stout spines, respectively; chelicerae groove with 4 / 4 and 3 / 3 teeth of different sizes on promargin and retromargin, respectively.

Leg formula 4123; measurements: I 15.75 (4.84, 2.29, 3.77, 3.21, 1.64), II 12.29 (3.42, 1.94, 2.94, 2.68, 1.31), III 11.60 (3.33, 1.26, 2.05, 2.93, 2.03), IV 16.19 (4.61, 1.49, 3.57, 4.34, 2.18). Spines on femora to metatarsi of legs I – II straight, sword-like (typical); spines on the prolateral patellae of leg I-II typical, ventrally strong on leg I (especially distally), tip hooked, but absent on leg II; spines on prolateral tibiae several typical, less numerous on leg II, ventrally more elongate, two especially elongate adjacent spines proximally on leg II (Fig. 11 F and Fig. 16 a , b ). Short spines on tarsi I – II, spineless III-IV. Spination of right leg I, patellae, Dpv (1), Mrd (1-1 - 1), rv (1-1 - 2); tibiae, Drv (2), pv (1-1 - 2 - 1 - 2 - 2 - 2 - 1 - 2), rl (1-1 - 2 - 2 - 3 - 1 - 2); metatarsi, pl (2-2 - 1 - 1 - 1 - 1 - 1), rl (2-2 - 1 - 1 - 2 - 1 - 2); tarsi, Mp (1-1 - 1), Mr (1-1 - 1 - 1 - 1). Spination of leg II, patellae, Mpd (1-1 - 2) / (1-1 - 2), Drv (1) / (0); tibiae, Mp (1-1 - 1) / (1-1 - 1 - 1), Dpv (2) / (2), rv (2-1 - 1 - 1) / (2-1 - 1 - 2), Drv (1) / (2); metatarsi, pl (1-1 - 1 - 1 - 1 - 1 - 1 - 1 - 2) / (1-1 - 2 - 1 - 1 - 1 - 3); tarsi, Mp (1-1 - 1 - 1 - 1 - 1) / (1-1 - 1 - 1 - 1), Mr (1) / (1-1 - 1). Tibia III unmodified, without demi-saddle shape. Trichobothria of legs present on proximal one-third part of tibiae I – IV, distal half of metatarsi I – III, distal two-thirds part of metatarsus IV and dorsal side of all tarsi; trichobothria on tibiae I – IV and metatarsi I – IV unmodified; trichobothria on tarsi divided into unmodified and clavate forms, with former irregularly distributed across almost entire dorsal surface and latter only present in proximal half. Count of trichobothria on legs: I, tibia 3 pd and 2 rd, metatarsus 7, tarsus 14 unmodified and 4 clavate; II, tibia 4 / 5 pd and 3 / 4 rd, metatarsus 7 / 7, tarsus 11 / 15 unmodified and 3 / 7 clavate; III, tibia 4 / 5 pd and 4 / 5 rd, metatarsus 7 / 8, tarsus 13 / 13 unmodified and 1 / 3 clavate; IV, tibia 5 / 5 pd and 6 / 6 rd, metatarsus 7 / 8, tarsus 11 / 10 unmodified and 1 / 1 clavate. Tarsal claws: paired claws with six teeth on tarsus I (Fig. 11 E), four teeth on tarsi II – III, two teeth on tarsus IV, unpaired claw bare, without denticle.

Palp 6.62 long (2.81, 0.99, 2.05, 0.77). Trichobothria on palpal tibia unmodified, present on proximal half part, on cymbium divided into unmodified and clavate forms, with latter occupying majority of trichobothrial area, while former sparsely distributed at distal end of trichobothrial area; count of trichobothria: tibia 1 / 3 pd, 2 / 3 rd, cymbium 2 / 4 unmodified and 1 / 3 clavate. Tibia cylindrical, slightly outwards in the middle ventral, with one lyriform organ on ventro-prolateral side of sub-distal part (Fig. 9 E – F). Spination of tibia, Dmp (1-1 - 1 - 1) / (1-1 - 1 - 1), Mr (7) / (7). Palpal organ: tegulum oval; embolus approximately 1.3 times the tegulum width, with one elevated embolic keel extending from retrolateral side of proximal one-third part of embolus to distal one-third part of ventral side (Fig. 10 D – F); embolus slight bent to retrolateral at distal one-third part of embolus; apex of embolus with an apophysis (Fig. 10 C).

Diagnosis

The male of new species morphologically resembles those of geographically close L. yaoi sp. nov. on the general morphology of palpal bulb and the pattern of spines on the palpal tibia, but it can be distinguished from L. yaoi by the relatively low keel of embolus and the reduction of number of spines on male palpal tibia (Fig. 9 E – F and Fig. 13 F – G). Another species known only from a historical female specimen from the same wider zone is L. davidi (i. e. from Moupingzhen, Sichuan). Whilst direct comparisons are problematic due to sexual dimorphism, the male L. wenchuan sp. nov. lacks stridulatory ridges on the retrolateral checlicerae as found in the female of L. davidi ( Decae and Caranhac 2020) , but which may be expected in the undescribed male as similar structures are found in both sexes on L. stridulans ( Decae et al. 2019) .

Etymology

The specific epithet is derived from the type locality; noun in apposition.

Distribution

Known only from the type locality of Sichuan, China (Fig. 17 ).

DNA barcode

AAAGATATTGGAACTTTATATATGATTTTTGGTGTATGATCGGCTATGCTAGGGACTGCTATAAGAGTAATTATTCGAGTTGAGCTTGGTCAGGTTGGTAGATTGTTTGGGGATGATCATTTGTATAATGTTATTGTTACTGCTCATGCTTTAGTTATGATTTTTTTTATAGTTATGCCTATTATAATTGGTGGTTTTGGGAATTGATTGCTTCCATTAATGATTGGTTCACCAGATATGGCTTTTCCTCGTATAAATAATTTAAGATTTTGATTGCTTTTCCCTTCTTTATTTTTATTGTTGTTATCTTCTATAACGGATATTGGGGTGGGTGCTGGATGGACTATTTATCCTCCATTATCTTCTGATTTAGGACATAGAGGAGGAGGGGTAGATTTTGCTATTTTTTCTCTTCATTTGGCTGGAGGGTCTTCAGTAATAGGTTCTATTAATTTTATTTCTACTATTTTTAATATACGTCCTTTTGGGATAACAATAGAACGAGTTCCTTTATTTGTGTGATCTGTGTTAATTACAACTATTTTGCTTTTATTGTCTTTGCCAGTTTTAGCTGGAGCTATTACTATACTATTAACTGATCGAAATTTTAATACTTCATTTTTTGATCCTGCTGGTGGTGGGGATCCGGTATTATTTCAGCATTTGTTTTGATTTTTTGGTCAC (GenBank accession number: PQ 585637).

Figures

Figure 9. Latouchia wenchuan sp. nov. Holotype male. A, B Habitus; C Ocular area; D Sternum; E, F Palp. In prolateral (E), retrolateral (F), dorsal (A, C) and ventral (B, D) view.

Figure 10. Palp of Latouchia wenchuan sp. nov., holotype male. A Palp; B Spines on the tibia of palp; C Apex of embolus; D – F Bulb. In prolateral (C), retrolateral (B, F), dorsal (E) and ventral (A, D) view. Abbreviations: K – keel.

Figure 11. Latouchia wenchuan sp. nov., holotype male. A, B Palpal bulb; C Embolus; D Apex of embolus; E Claw of left leg I; F Patella and tibia of left leg II, showing the spination. In prolateral (F), retrolateral (B, C, E) and dorsal (A, D) view. Abbreviations: AE, apex of embolus; BE, base of embolus; DH, distal haematodocha; K – keel; ST – subtegulum; T – tegulum.

Figure 13. Latouchia yaoi sp. nov. A, C, E – H Holotype male; B, D, I Paratype female. A, B Habitus; C, D Sternums; E – G Palp; H Apex of embolus; I Vulva. In prolateral (F, H), retrolateral (G), dorsal (A, B, I) and ventral (C – E) view.

Figure 17. The type localities of Latouchia species of China: L. calcicola sp. nov. (1), L. jinyun sp. nov. (2), L. linmufu sp. nov. (3), L. wenchuan sp. nov. (4), L. yaoi sp. nov. (5), L. cornuta (6), L. wenruni (7), L. yuanjingae (8), L. hunanensis (9), L. rufa (10), L. formosensis (11), L. formosensis smithi (12), L. yejiei (13), L. davidi (14), L. fossoria (15) and L. pavlovi (16). The type locality of L. vinhiensis is uncertain.

Figure 16 a. Latouchia wenchuan sp. nov. Right leg I;

Figure 16 b. Latouchia wenchuan sp. nov. Left leg II;