Gielisella clarkeorum, Koster, J. C. (Sjaak) & Nieukerken, Erik J. van, 2017

Koster, J. C. (Sjaak) & Nieukerken, Erik J. van, 2017, Gielisella gen. n., a new genus and two new species from southern Spain (Lepidoptera: Elachistidae: Parametriotinae) with a catalogue of parametriotine genera, Nota Lepidopterologica 40 (2), pp. 163-202 : 170-175

Gielisella clarkeorum sp. n. Figs 1, 3-5, 6-7, 10, 11, 13, 14, 17, 18, 21-25, 26-27, 28, 29

Type material.

Holotype ♂, Spain, Almería, Enix, 36°52 ’38.49” N 2°36 ’24.83” W, 5.iii.2015, coll. nr. 580, leg. PJ & VF Clarke; gen. slide JCK 8361, RMNH.INS.544306 (RMNH).

Paratypes: 1♂, 8♀. Spain, Almería, same locality as holotype, all leg. PJ & VF Clarke: 1♀, 17.iii.2007, coll. nr. 099, gen. slide Clarke 99 (NHMUK); 1♀, 17.iii.2007, coll. nr. 122, gen. slide Clarke 122 (PGC); 1♂ [moth lost], 17.iii.2008, coll. nr. 171, gen. slide Clarke 171, RMNH.INS.15524 (RMNH); 1♀ [left wings prepared], 17.iii.2008, coll. nr. 166, gen. slide Clarke 166, wing slide JCK 8200 (MNCN); 1♀, 17.iii.2008, coll. nr. 173, gen. slide Clarke 173 (PGC); 1♀ [specimen not spread], 15.ii.2013, coll. nr. 435, gen. slide JCK 8363, RMNH.INS.544295 (RMNH); 1♀ [specimen not spread], 21.iii.2013, coll. nr. 445, RMNH.INS.544296 (PGC); 1♀ [specimen not spread], 18.iii.2014, coll. nr. 544 (PGC). Spain, Granada, 1♀, Yator, 22.iv.1978, [leg. C. Gielis]; " Agonoxenidae gen.nov. spec.nov. det J.C.Koster, prep 3850 ♀", "Museum Leiden, ex collectie C. Gielis", "B. hellerella [handwriting Gielis]", RMNH.INS.15525 (RMNH).

Diagnosis.

Gielisella clarkeorum can be separated from G. nigripalpis by the pale tipped palpi, and the longitudinal dark streaks on the forewings. In the male genitalia it differs by the two groups of setae on the uncus; by the wide and cylindrical apex of the anellus lobes with a lateral projection near the apex, the more longitudinal shape of the valvae and by the gradual increasing length of the cornuti.

Description.

Male (Fig. 11). Forewing length 6.7 mm. Head: frons shining white with greyish brown irroration ventrally, vertex, neck tufts and collar shining white, irrorate greyish brown; labial palpus first segment white, second segment white with irrorate greyish brown streak on outside, extending into subapical ventral spot, third segment white with irregular narrow subbasal ring white and greyish brown tipped scales and similar coloured, broad subapical ring; scape dorsally white, strongly irrorate greyish brown with white anterior line, ventrally greyish white with 8-9 pecten hairs; flagellum shining brownish grey, basal six segments whitish. Thorax and tegulae shining ochreous-white, strongly irrorate greyish brown; thorax with broad dark greyish brown medial line, tegulae broadly lined white posteriorly. Legs: dorsally shining dark greyish brown, ventrally white with some greyish irroration; tibia midleg with white basal and medial streaks and white apical ring, tarsomeres one to four with whitish apical rings; tibia hindleg dorsally pale ochreous-grey, tarsomeres as midleg; spurs midleg and inner spur hindleg whitish, outer spurs hindleg dark brown. Forewing ground colour whitish more or less irrorate by greyish ochreous and greyish brown scales with dark brown and ochreous-yellow streaks in costal half and in apical area, the dark streaks almost fused; in middle of wing at two-fifths, dark brown elongated spot, at costal side connected to streak, edged white; two dark brow tufts of raised scales, first below fold at one-third, second and largest subdorsally at two-thirds, last spot surrounded by white scales, touching streak costally; white spot at apex connected to dark brown spot in apical cilia; several small dark brown spots in costal cilia; two dark brown fringe lines; cilia greyish white. Hindwing shining greyish white; cilia greyish white. Underside: forewing shining brownish grey; hindwing shining greyish white. Abdomen dorsally shining greyish brown, segment seven shining white banded posteriorly; ventrally shining greyish white; anal tuft shining white.

Female (Figs 1, 28). Forewing length 5.1-6.9 mm. femur foreleg apically with white dorsal spot. Forewings with streaks and spots clearly separated, not fused, overall paler than male. Anal tuft ochreous-brown.

Male genitalia (Figs 6, 7, 13, 14, 17, 18). Uncus broad and very short, with 16 setae in two groups. Gnathos arms long and slender, upwards curved at one-third of base, upper side transversely covered with pecten of 32-33 flat peglike setae, about one and half width of gnathos arm (Fig. 14). Tegumen large, longer than wide, slightly narrowing distally. Valvae long, strongly narrowing after one-third, distally slightly widening till 3/4 and slightly narrowing apically with rounded tip, edges and apex weakly spiny. Anellus lobes large, strongly sclerotized, ventral edge with short spines, strongly tapering distally with distal third more or less cylindrical, apex with three curved teeth and laterally with irregular projection, both combined with several spicules. Vinculum broad with heart-shaped saccus and shield-shaped juxta. Phallus (Figs 7, 17, 18) long, curved ca. 90 degrees, slightly tapering distally, apex pointed, vesica with narrow row of approximately 15 slender cornuti in distal half, cornuti gradually becoming longer towards tip.

Measurements: Length from vinculum to uncus 460 μm, width 435 μm, valva length 560 μm, width 200 μm, phallus length (measured in straight line) 765 μm; longest cornutus 110 μm.

Female genitalia (Figs 10, 21-25). Papillae anales short and rounded. Apophyses anteriores 1/4 shorter than apophyses posteriores. Antrum wide, bowl-shaped. Ductus bursae long, basal half lobed, small section below antrum narrow with partly sclerotized wall, followed by cleavage into ductus bursae and ductus seminalis, distal half of ductus bursae with irregular row of spicules. Corpus bursae egg-shaped, single signum as rectangular field of spines of variable size.

Distribution

(Fig. 29). Spain, provinces of Almería and Granada. Type locality: 36.8770°N, 2.6036°W. The locality of the specimen from Granada was reconstructed by the collector as either 36.9544°N, 3.1436°W or 36.9528°N, 3.1375°W.

Biology.

Host-plants and early stages are unknown. The adults have been collected at light from the end of January till late April. The specimen from Granada was collected on a dry northern slope of a hill at an elevation of approximately 700 m. The vegetation consisted, among other things, of small shrubs and herbs belonging to Asteraceae , Cistaceae and Poaceae (Gielis, pers. comm.). The specimens from Almería were taken in a garden at the edge of a suburban area on the south facing slope of the Sierra de Gádor at an elevation of 720 m (Figs 26-27). In the garden grow amongst others the vines and shrubs Clematis cirrhosa L. ( Ranunculaceae ), Jasminum officinale L. ( Oleaceae ), Rosa spec. ( Rosaceae ) and the following trees grow nearby: olive ( Olea europaea L., Oleaceae ), apple ( Malus pumila Mill., Rosaceae ), almond ( Prunus dulcis (Mill.) D.A.Webb, Rosaceae ), silver wattle ( Acacia dealbata Link, Fabaceae ) and at about 50 m from the collecting site a large eucalypt tree (probably Eucalyptus gomphocephala A.Cunn. ex DC., Myrtaceae ), that was felled in 2015; weeds include Salsola sp. ( Amaranthaceae ) and Dittrichia viscosa (L.) Greuter ( Asteraceae ). The adjacent orchard area has an undergrowth of Poaceae , Juncaceae and Rubus sp. ( Rosaceae ) (Figs 26, 27). According to the collectors, the species started to appear in their garden after they planted the native Clematis cirrhosa L., and adults seem to hide in it. This observation requires further study.

DNA barcodes.

We barcoded three specimens, including the holotype, resulting in three identical barcodes, with BIN BOLD:ACU7245 (Table 1).

The barcode reads:

aactttatattttatttttggaatttgagcaggaatagtaggaacatcacttagtttattaattcgagctgaattaggaaccccaggctctttgattggagatgaccaaatttataatactattgtcacagctcatgcttttattataattttttttatagtaatacctattataattggaggatttggtaactgattagttcctttaatattaggagcccctgatatagcattccctcgaataaacaatataagtttctgacttttacccccttctattactcttctaatttcaagtagtattgtagaaaatggagctggaacaggatgaacggtttacccccccctttcatctaatattgctcatagaggtagatcagttgatttagcaatcttttctcttcatttagctggaatttcttctattttaggagctattaattttatcacaactattattaatatacgtctaataaatatatcttttgatcaaatacctttatttgtttgagcagttggaattacagctttacttctgcttctttctttacctgttttagctggagctattactatgttattaacagatcgtaatctaaatacttcattttttgaccctgctggtggaggagacccaattctttatcaacatttattt

Etymology.

The specific epithet clarkeorum , a noun in genitive plural, is a tribute to the collectors of both species, Peter and Ginny Clarke.

Remarks.

The forewing of the male holotype is darker than in all females examined, and the pattern elements are more or less fused. Whether this constitutes sexual dimorphism or simple variation can only be decided after collecting more males. We decided to select the male as holotype, since the male genitalia provide the best characters, and only males are known of the next species G. nigripalpis .