Wernerius inyoensis, Webber, Michael M., Graham, Matthew R. & Jaeger, Jef R., 2012

Webber, Michael M., Graham, Matthew R. & Jaeger, Jef R., 2012, Wernerius inyoensis, an elusive new scorpion from the Inyo Mountains of California (Scorpiones, Vaejovidae), ZooKeys 177, pp. 1-13 : 3-9

Wernerius inyoensis sp. n. Figs 114

Type material.

United States: California: male holotype, Loretta Mine Road, Inyo Mountains, Death Valley National Park, 37.2299°N, 117.9568°W, 1706 m, 9 September 2009, M.R. Graham and G.M. Graham Jr. (DEVA 54174).

Etymology.

The specific epithet refers to the type locality in the Inyo Mountains, California.

Diagnosis.

Small in size, with the only known adult male less than 17 mm in total length. Yellow-orange base color with darker carinae on the pedipalps, and segments of the metasoma. Genital operculum divided below posterior one fifth, carapace very slightly emarginate; pectine count 11-11; 7 inner (ID) denticles on the pedipalp movable finger and 6 on the fixed finger.

Although specimens of Wernerius spicatus and Wernerius mumai were not available for study (Sissom pers. comm.), based on the original descriptions of these species ( Haradon 1974, Sissom 1993), it appears that Wernerius inyoensis sp. n. is morphologically most similar to Wernerius spicatus . Both species share ID denticle counts, have similar femur and patella L/W ratios, and overlap in pectine tooth counts. However, Wernerius inyoensis sp. n. differs from Wernerius spicatus by having larger metasomal and pedipalp dimensions. Wernerius inyoensis sp. n. also differs from Wernerius spicatus in hemispermatophore morphology. The length of the lamellar hook in Wernerius inyoensis sp. n. is relatively short and the dorsal trough is shallow as indicated by the ratio of the lamellar hook length/length of the entire lamina (0.338) when compared to that of Wernerius spicatus (0.439). In addition, the basal constriction is less well-defined in Wernerius inyoensis sp. n. as indicated by the ratio of width at lamellar hook/lamina length ( Wernerius inyoensis sp. n. = 0.169; Wernerius spicatus = 0.123). The distal end of the lamina is also straighter and wider than Wernerius spicatus , which exhibits a slight curve and tapers posteriorly (ratio of width at distal end of lamina/width at lamina midpoint; Wernerius inyoensis = 0.900, Wernerius spicatus = 0.652). The ratio of the total width of the lamina at the midpoint/inner surface of the lamina groove to the right lateral surface of the lamina, indicates that the lamellar spine of Wernerius inyoensis sp. n. (1.33) is wider than that of Wernerius spicatus (1.09).

Wernerius inyoensis sp. n.can be distinguished from Wernerius mumai by the following combination of characters: smaller adult size (of the holotype, <17 mm), more robust femur (L/W ratio 3.54) and a shorter, thinner pedipalp, 5 OD denticles on the pedipalp movable finger in addition to 5 on the fixed finger, and ventral metasomal setae counts. Inframedian carinae are crenulate and complete on metasomal segment I, and cover the posterior half of metasomal segments II and III. A comparison of characters is provided in Table 1.

Description of holotype.

Color: Carapace, tergites, femur, patella, and metasoma have a yellow-orange base color with dark brown to black markings on the chela and along carinae of the metasoma. Legs are yellow and slightly lighter in color than the rest of the body. Pedipalp chela is yellow-orange in color with darker reddish-brown coloration at the anterior portion of the palm where the fixed finger and movable finger meet. Chelicerae are yellow with mottling on distal half. Telson is dark-yellow to orange bordered by dark brown carinae. Pectines and genital operculum are light yellow.

Morphology.

Carapace: anterior margin very slightly emarginate, with three lateral eyes on each side; moderately convex dorsolaterally; finely granular with scattered small granules, with larger granules symmetrically flanking the median furrow; median furrow is slight and traverses length of carapace, excluding the median eyes; ratio of median eyes location (from anterior edge)/carapace length = 0.32; carapace length/width at median eyes = 1.44. Tergites: slightly granular with weak median carinae from distal half of tergite I, and terminating at the middle of segment VII; strong granular dorsolateral and lateral supramedian carina on posterior 4/5s of VII; pretergites very finely granular. Sternites: I–V smooth to very finely granular and without carinae; V with granular ventral lateral carinae on posterior 1/5 to posterior 3/5. Spiracles: ovoid with median side parallel to posterior sternite margin. Genital Operculum: sclerites separated on posterior 1/5 with genital papillae protruding slightly beyond posterior of operculum plates. Pectines:tooth count 11/11; middle lamellae 5/6. Metasoma: ratio of segment I length/width 0.81; segment II length/width 0.91; segment III lengt h /width 0.89; segment IV length/width 1.14; segment V length/width 1.58. Segments I–IV: dorsolateral carinae are strong and serrate, with distal denticle of I–IV enlarged and spinoid; denticle size is largest on segments III and IV and smaller on segments I and II; possesses intermediary carinae on segments I, II, and III; inframedian carinae are crenulate, and traverse the entire length of segment I, and ½ of the posterior portion of segments II and III, lateral supramedian carinae I–III possesses serrated granules and enlarged spinoid distal denticle; carinae of segment IV are less pronounced, crenulate to serrate, and flared on distal terminus; a space exists between the dorsolateral and supramedian carinae of segments I–III, and 1/3 of segment III; intermediary carinae are less distinct and are more granular than the ventrolateral carinae; ventral carinae are weakly serrate, but less distinct than dorsal carinae; ventrolateral carinae I strong, crenulate to serrulate; on II–III serrulate to serrate; on IV crenulate to serrate; ventral submedian setae 3/3:3/3:3/3:3/3:3/3. Segment V: dorsolateral carinae moderate, granular; lateromedian carinae moderate and granular on anterior 4/5, obsolete on distal 1/5; ventrolateral and ventromedian carinae crenulate to weakly serrate; intercarinal spaces are finely granular; ventrolateral setae 2/2:2/2:2/2:2/2:3/3.

Telson: smooth to slightly granular with very pronounced subaculear tubercule; 3/1 LAS denticles ( Fet et al. 2006). Chelicerae:dorsal edge of movable cheliceral finger with two subdistal (sd) denticles; ventral edge smooth to well developed serrula on distal 2/3. Pedipalps:trichobothrial pattern type C (Figs 3-9); ratio of chela length/width 3.84; femur length/width 3.54; patella length/width 3.69; fixed finger length/carapace length 0.36. Chela:carinae weak and smooth except for a few weak to moderate granules on D4 and D5; median (MD) denticles of fixed finger aligned and divided into six subrows by five outer (OD) denticles flanked by six inner (ID) denticles; movable finger with six subrows, five OD denticles and seven ID denticles; movable finger shorter than the carapace and slightly shorter than metasomal segment V. Femur: dorsoexternal, dorsointernal, and ventrointernal carinae denticulate, ventroexternal is slightly serrate; internal surface covered with small granules throughout. Patella:internal carinae are granulose with 5 dentate denticles; all other carinae weak to non-existent. Legs: ventral surface of tarsus with single median row of spinules terminating distally with one spinule pair. Hemispermatophore (Figs 11-12): the specimen has a wide hemispermatophore trunk with a well defined truncal flexure; the dorsal trough is shallow, with its base terminating at the distal end of the truncal flexure and tapers posteriorly; the lamellar hook is relatively large and strongly bifurcated at the distal tip, and also possesses a strong groove and slight basal constriction; the length of the lamellar hook is relatively short and the dorsal trough is shallow as indicated by the ratio of the lamellar hook length to the length of the entire lamina (0.338).

DNA barcode (COI)

- GCTTCTATGGTAGGGACAGCTTTGAGAT TAATAATTCGTATTGAGATTGGAAGTCCTGGGTCTTTTATTGGAGA TGATCAAATTTATAATGTTGTTGTTACTGCTCATGCTTTTGTAAT GATTTTTTTTATGGTAATACCAATTATAATTGGAGGTTTTGGAAATTG GTTAGTCCCTTTAATGTTGGGGGCTCCTGATATGGCTTTCCCTCGTT TAAATAATATAAGTTTTTGGTTATTACCTCCTGCATTTTTTTTATTATT AGGGTCAGCTTCATTGGAAAGAGGCGCAGGGACAGGCTGAACTGT GTACCCGCCTCTTTCCTCATATATGTTCCATTCTGGTGGTTCTGTT GATATGACTATTTTTTCTTTACATTTAGCTGGAGTTTCTTCAATTT TAGGAGCTATTAATTTTATTACTACTATTTTAAATATACGTATAAGTG GAATATTATTGGAGCGTATTCCTTTGTTTGTATGATCTGTAAGGAT TACTGCTATTTTATTACTTCTTTCTCTTCCCGTTCTTGCAGGGGC TATTACTATACTATTAACTGATCGAAATTTTAATACTTCTTTTTTT GATCCTGCAGGAGGGGGAGATCCCATTTTATATCAGCATT TATTTTGATTTTTTGGACATCCTGAAGTTTATATTTTAATTCTTC CTGGGTTTGGAATGGTTTCTCATATTATTAGTCATCATACTG GAAAGAGGGAGCCTTTTGGAGCTTTGGGAATGATTTATGCAATG GTTGCTATTGGGTTTTTAGGATTTGTTGTTTGGGCTCATCATAT GTTTACTGTTGGAATAGATGTTGATACTCGAGCTTATTTTACT GCTGCTACTATGGTTATTGCTGTTCCTACTGGGATCAAAATTTT TAGATGATTAGCTACTTTACATGGTTCTTATTTTGTCTTTACGC CCCCTCTTTTGTGGGCTTTGGGATTTGTTTTTCTATTTACTG TAGGAGGTTTAACTGGTGTAATTTTAGCTAATTCTTCTTTGGA TATTGTTCTTCATGATACTTATTATGTTGTAGCTCATTTTCAT TATGTTTTGTCTATAGGAGCAGTTTTTGCCATTATTGCTGGAATT GTTGAATGGTTTCCTCTATTTTTAGGTTGTCAGATGAGTGAGCG TATATTAAAAATTCATTTTTTTGTGATGCTTTTGGGGGTAAAT

Mensuration (mm).

Male holotype: total length 16.4; carapace length 2.38; mesosoma length 4.89; metasoma length 7.48 (excluding telson); Metasoma: segment I length/width 1.05/1.29; segment II length/width 1.19/1.31; segment III length/width 1.24/1.40; segment IV length/width 1.71/1.50; segment V length/width 2.29/1.45. Telson: length 2.27; vesicle length/width/depth 1.67/1.10/0.76; aculeus length 0.60. Pedipalps: total length 7.95; femur length/width 2.02/0.57; patella length/width 2.36/0.64; chela length 3.57; palm length/width/depth 1.98/0.93/1.12; movable finger length 2.24; fixed finger length 1.79.

Distribution.

Known only from the type locality in the Inyo Mountains of California where it was collected at an elevation of 1706 m.

Subterranean hypothesis.

The southwestern United States is one of most well-studied areas in the world in terms of scorpions, so it is puzzling that a genus as widespread as Wernerius is so infrequently encountered. Previous authors have attributed their rarity to low densities or sporadic surface activity ( Sissom 1993), but we provide a third potential explanation, that Wernerius are primarily subterranean.

Recent studies of invertebrates inhabiting the deep soil strata (euedaphon) in Bulgaria have revealed a rich spider fauna ( Deltshev et al. 2011). Incredibly, the different soil strata each contained a unique assemblage of spiders, many of which exhibited various degrees of morphological adaptations to underground environments. One species, Zangherella relicta ( Kratochvíl 1935), was only found within the deepest strata surveyed. We hypothesize that Wernerius inyoensis sp. n. may inhabit similar environments in the North American Southwest, particularly areas of piled rock or talus slopes (Fig. 13, 14). Despite the fact that Wernerius are uncommonly encountered, two other lines of evidence support our hypothesis. Each species has only been collected from extremely rocky habitats, and each species is incredibly small (<25 mm), perhaps enabling them to easily maneuver within the interstitial spaces of piled rock and talus. If true, then perhaps these small and mysterious scorpions occur at higher densities across a much wider distribution than currently known.