Dimorphacanthella mediaseta, Potapov, Mikhail B., Bu, Yun, Huang, Cheng-Wang, Gao, Yan & Luan, Yun-Xia, 2010

Potapov, Mikhail B., Bu, Yun, Huang, Cheng-Wang, Gao, Yan & Luan, Yun-Xia, 2010, Generic switch-over during ontogenesis in Dimorphacanthella gen. n. (Collembola, Isotomidae) with barcoding evidence, ZooKeys 73, pp. 13-23 : 18-20

publication ID

https://dx.doi.org/10.3897/zookeys.73.839

persistent identifier

https://treatment.plazi.org/id/C9CB3499-9315-22CF-2BC6-23D0EB40086F

treatment provided by

ZooKeys by Pensoft

scientific name

Dimorphacanthella mediaseta
status

sp. n.

Dimorphacanthella mediaseta   ZBK sp. n. Figs 8-13

Material.

Holotype: Subadult female with an aperture but not fully developed, body length 0.81mm, NW China, Ningxia Province, Longde County, Shatang Town, Shatang Nanshan Mt. (a little mountain belongs to LiuPan Mountain), 35°23'N, 106°17'E, 1900 m alt., sparse shrubs and birch, 1.VI.2006, Y. Bu, Y. Gao and Y.X. Luan leg.

Paratypes: All from the same area as holotype (Ningxia Province, Liupan Mountain Nature Reserve,), from different localities, all collected by Y. Bu and C.W. Huang. 1 subadult female, body length 0.83mm, same date of Holotype; 1 subadult female, 2 juveniles, Jingyuan, Dongshanpo Forest Farm, Sam 11, 35°37'N, 106°13'E; 2297 m alt., valley, beside a stream, black soil, shrubbery. 24.VI.2008, 1 subadult female, 1 juvenile, Jingyuan, Qiuqianjia Forest Farm, Sam 2; 35°33'N, 106°24'E; 1868 m alt., slope beside a stream, clinosol with many dull leaves, moist soils. 06.VII.2008, 1 subadult female, 4 juveniles, Jingyuan, Woyangchuan Forest Protection Area, 35°39'N, 106°23'E; 1762 m alt., one place is slope, clinosol with dull leaves and humus, another one at the foot of the hill, forest litter, yellow and dry soils with many dull leaves. 29.VI.2008, 3 subadult females, 1 subadult male, 3 juveniles, Longde, Fengtai Forest Farm, 35°35'N, 106°13'E; 2399 m alt., valley, forest litter. 25.VI.2008, 2 juveniles, Longde, Heshangpu Forest Farm (Sam 2; 35°40'N, 106°13'E; 2300 m alt.), valley, forest litter, moist soils. 27.VI.2008, 1 subadult female, Jingyuan, Erlonghe, Xiaonancuan Forest Protection Area, 35°23'N, 106°17'E; 2163 m alt., slope beside a ditch, under a rotten tree stump, crumbly soils. 10.VII.2008, 5 subadult females, 5 males, Jingyuan, Dongshanpo Forest Farm, 35°36'N, 106°15'E; 2125 m alt., foot of cliff, moist soils and moss on the stone. 23.VI.2008.

Holotype and the most paratypes are deposited in Shanghai Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, CAS (China), except 3 paratypes are kept in Moscow State Pedagogical University (Russia).

Description.

Size of adult males and subadult females up to 1.0 mm (adult female not seen). Body shape slender, general appearance somewhat that of the genus Stenaphorura (Absolon, 1900) ( Onychuridae ). No pigmentation. Body with well visible reticulation, no elongated polygons. With 4 strongly chitinized anal spines arranged almost in one transversal row at the end of abdomen. Inner anal spines 1.1-1.4 times longer then outer spines. Ocelli absent. PAO narrowly elliptical, with weak constriction, 1.8-2.2 as long as unguis 3. Outer mouth parts as in previous species, labial palp shown in Fig. 9. Maxillary claw strong, lamellae not beyond its tip. Ventral side of a head with 3+3 postlabial setae. Ant. I with 11 (rarely with 10) setae, 2 bms, dorsal and ventral, and 2 ventral s, one of them curved and 3-4 times longer than another. Ant. II normally with 17 setae, 3 bms and one curved s. Ant. III without bms and with 5 s, inner pair of sensilla of AO much shorter and set in cuticular groove (Fig. 8). Several differentiated sensilla on Ant. IV, subapical organite small, subapical microsensillum short.

Chaetotaxy of body shown on Figs 10-11. Tergal sensilla well visible, much shorter than ordinary setae. Sensillary formula 2,1/1,1,1,2,4 (s). In one individual 2 sensilla on one side of Th. III. Sensilla thinner than ordinary setae, on Abd. V sensilla of lateral pair thin and twice as long as the medial ones. Microsensilla large, set near sensilla, microsensillary formula 1,0/0,0,1 (ms). Tergites with a sparse cover of ordinary setae. Dorsal axial chaetotaxy of Th. II–Abd. IV as 12(14),10(9)/8,8,8,7 (including macr osetae Md). Macrochaetotaxy 1,1/2+1,2+1,2+1,4. In axial group of Abd. I-III a pair of small Md macroseta present (notated as ‘+1’ in formula and encircled on Fig. 10). Short Md macroseta appears to be also present in axial group of Th. II and III but hardly differentiated. Ml macroseta on Th. II 2.6-3.1 as long as p1-seta. Md macroseta on Abd. IV 1.7-2.2 as long as p0-seta and 2.5-3.3 as long as unguis 3. Sternum of Th. I without setae, sternums of Th. II and III with 1+1 and 3(2)+3(2) setae, respectively.

Unguis without inner and lateral teeth. Unguiculus simple, without lamella, 0.4-0.5 as long as unguis 3. Ti. I-III with 21, 21, 22 setae, without additional setae (Fig. 12). Only one seta slightly modified on inner side of Ti. III in both sexes. Tibiotarsal tenent setae weakly developed. Ventral tube with 4+4 laterodistal and 4 posterior setae in one transversal row. Ventrum of Abd. I with four medial setae, two anterior and two posterior. Furca and tenaculum completely absent. Furcal subcoxa with 9-11 setae, of which two longer setae, macrosetae in posterior position and anterior slightly enlarged seta (Fig. 13). Manubrial field normally with 3 pairs of setae. Retinacular field with 2 setae. Each anal lobe with 2 rudimentary setulae, not always distinct. Males present.

Remarks.

The new species differs from Dimorphacanthella anommatos by presence of medial pair of macrosetae on the first three abdominal tergites. Sensilla on tergites, especially lateral pair on Abd. V, are thinner than in Dimorphacanthella anommatos . Seta p2 on Abd. V also sharply discriminates these two species (in more posterior position in Dimorphacanthella mediaseta , Figs 1 and 10). Number of anal spines in small juvenile individuals is unknown.

Name derivation.

The name refers to medial macrosetae on body differentiating the new species.

Barcoding analysis.

DNA barcoding sequence was proved very efficient for characterising Collembolan species ( Hogg and Hebert 2004). Here, we used barcode in order to validate those two forms of Dimorphacanthella anommatos are really belong to the same species, in spite of strong morphological differences.

Collembolan specimens.

Collembolan species for DNA barcoding analysis were collected from Zhongjia Mountain, 31°05'N, 121°09'E, 25 m alt., Songjiang county, Shanghai city in 75% ethanol by the Tullgren funnel method. They were stored in 100% ethanol at -20°C after morphological identification. We barcoded separately 2 individuals of ' Tetracanthella anommatos ' with four anal spines and 4 individuals of ' Uzelia anommatos ' with two anal spines.

DNA extraction, amplification and sequencing.

Genomic DNA was extracted from one individual using the Wizard SV Genomic DNA Purification System (# 2361). The mitochondria COI gene sequence was amplified (658 bp) by primer pair LCO (5' - GGTCAACAAATCATAAAGATATTGG-3') / HCO (5 ’– TAAACTTCAGGGTGACCAAAAAATCA–3’) (modified from Folmer et al. 1994). We use the following profile: 94°C initial denaturing for 4 min; 10 cycles of 94°C denaturing for 30 s, 45°C annealing for 30 s, and 72°C extension for 1 min and 30 s; then, with 25 cycles of 94°C denaturing for 30 s, 50°C annealing for 30 s, and 72°C extension for 1 min and 30 s; and a final extension at 72°C for 8 min. PCR products were purified and then were sequenced directly using both of the amplification primers.

Results.

Six sequences (length 658 bp) were obtained from 6 individuals. The two individuals of the four-spined form showed the same sequence, as the four individuals of the two-spined form. This suggested that the two forms are a same species in agreement with our morphological result. GenBank Accession number of barcoding sequences are HM366600 and HM366601.