Oxynetra aureopecta A. Warren & Grishin

Warren, Andrew D. & Grishin, Nick V., 2017, A new species of Oxynetra from Mexico (Hesperiidae, Pyrginae, Pyrrhopygini), ZooKeys 667, pp. 155-164 : 155-156

Oxynetra aureopecta A. Warren & Grishin sp. n. Figs 1-4, 11 part

Description.

Male (Figs 1-4): right forewing length 21.8 mm (holotype). Hindwing (HW) narrow and elongate; forewing (FW) extending well beyond it. Outer wing margin slightly concave at cell CuA2‒1A+2A of FW and at cells between veins M1 and M3 of HW. Dorsal and ventral FW (including fringe) brownish-black with blue-purple metallic sheen, and with a hyaline band from anterior edge of discal cell (where it is widest) to vein 1A+2A; band divided into three aligned parts by dark-scaled veins CuA1 and CuA2; its outer edge does not extend beyond the origin of vein M3; the hyaline wedge at the very base of cell M3‒CuA1 is either very small (holotype) or lacking (paratype). Dorsal HW concolorous with FW (except fringe around tornus white), with two median, large, aligned, hyaline spots in cell Sc+R1‒Rs (oval) and in discal cell (roughly triangular), separated by vein Rs, and suggesting continuation of FW band; smaller, postmedian pair of hyaline streak-like spots in proximal ends of cells M3‒CuA1 and CuA1‒CuA2; a small patch of white hair-like scales in the discal part of cell 2A-3A. Ventral HW similar to dorsal, but with wing base white and with a diffuse patch of white scales in discal part of cell CuA2‒1A+2A. Antenna black; nudum (missing on paratype) medium brown, 20 segments. Head and body primarily brownish-black with a blue-purple sheen, marked as follows: two small white spots at base of antenna and one small spot at dorsoposterior margin of eye; first and second segments of palpi orange ventrally; forecoxae orange; white patches at posterior margin of each sternite and on sides of abdomen; large orange spot on anterior half of tegula; five orange bands across terga III to VII. Genitalia not dissected. Female unknown.

Barcode sequence of the holotype.

Genbank Accession KT272397, voucher NVG-14113A02, 658 base pairs:

AACTTTATATTTTATATTTGGAATTTGAGCAGGAATAATTGGAACTTCATTAAGATTACTAATTCGAACTGAATTAGGTA

CCCCCGGATCTTTAATTGGAAATGATCAAATTTACAATACTATCGTAACAGCTCATGCATTTATTATAATTTTTTTTATA

GTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCAGATATAGCTTTTCCTCG

TATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTCTTTTAATTTCAAGAAGAACTGTAGAAAATGGTGTTG

GAACTGGATGAACAGTTTATCCCCCCCTCTCTTCTAATATTGCTCATCAAGGGGCCTCAGTTGATTTAGCTATTTTTTCT

CTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTT

ATCTTTTGATCAAATACCTCTTTTTGTATGAGCAGTAGGAATTACTGCATTACTATTATTATTATCTTTACCTGTATTAG

CAGGTGCTATTACTATACTTTTAACAGATCGAAATATTAATACTTCTTTTTTTGACCCAGCAGGTGGAGGAGATCCTATT

TTATATCAACATTTATTT

Types.

Holotype ♂ (Figs 1-2) with the following four rectangular labels: white, printed and handprinted - || PUERTO DEL CABALLO, | HIDALGO, MEXICO | SEPT. 8. '87. ||; white, printed - || WILLIAM H. HOWE | COLLECTOR ||; red, printed - || HOLOTYPE ♂ | Oxynetra aureopecta | A. Warren & Grishin ||; white printed - || DNA sample ID: | NVG-14113A02 | c/o Nick V. Grishin ||. The holotype is in the Los Angeles County Museum of Natural History, Los Angeles, CA, USA (LACM). Paratype ♂ (Figs 3-4) from MEXICO: Veracruz, Presidio, R. Mϋller Coll., in CNIABM.

Type locality.

MEXICO: Hidalgo: Puerto del Caballo, elevation about 1020 m, GPS approximately 21°10', −98°55'.

Etymology.

The name of this new species refers to its orange “chest”, including palpi beneath and forecoxae, which is the most obvious diagnostic character. The name is an adjective.

Distribution and habitat.

Oxynetra aureopecta is known only from the holotype and one paratype, both males, from Puerto del Caballo, Hidalgo, and Presidio, Veracruz, which are about 300 km from each other in eastern Mexico. Puerto del Caballo is situated at about 1020 m in the central Sierra Madre Oriental, along Hwy. 85, about 4.5 air km southwest of the San Luis Potosí border. This area is comprised of cloud forest vegetation, near the transition at lower elevations to tropical deciduous forest. The Presidio, Veracruz area has been extensively modified, and very few forested areas remain; material labeled from Presidio includes species typical of tropical deciduous and cloud forest habitats. The similar O. hopfferi and O. stangelandi are both cloud forest denizens, the latter reported to use Prunus annularis ( Rosaceae ) as a larval foodplant ( Grishin et al. 2013). Various Prunus species are likely present in the Puerto del Caballo area, including P. samydoides Schlecht., P. salicifolia HBK. and P. microphylla (Kunth) Hemsl. ( Standley 1920, Pennington and Sarukhán 2005), which could serve as foodplants for O. aureopecta .

Diagnosis.

This new species belongs to Oxynetra because it has the traits of the genus as defined by Evans (1951). In particular, "F end cell upright, convergent with termen at tornus" (Evans, 1951). By the COI DNA barcode, this species groups within Oxynetra as a sister to the O. hopfferi and O. stangelandi clade, in accord with similarities in appearance to these two species, and away from the O. semihyalina and O. confusa clade (Fig. 11). A combination of the following characters identifies males of O. aureopecta : (1) orange “chest”, i.e., forecoxae and palpi beneath (males of both O. hopfferi and O. stangelandi have white forecoxae and palpi); (2) no postdiscal white spot on ventral hindwing in cell CuA2-2A (the other two species possess this white spot in addition to the discal spot in that cell); (3) narrower forewing hyaline band barely extending distad the base of M3-CuA1 cell, and very small (or lacking) spot at the base of this cell (the band prominently extends distad of M3-CuA1 cell and the hyaline spot at the base of this cell is more prominent in the other two species); (4) longer (and narrower), streak-like spots in hindwing cells M3-CuA1 and CuA1-CuA2 (the spots, in particular the one in cell CuA1-CuA2, are rounder in the other two species); (5) five orange bands on the abdomen above, similarly to O. hopfferi (only a single complete band is present in O. stangelandi , Fig. 9); (6) a weakly developed white streak of a few hair-like scales near the anal fold on dorsal hindwing (the streak is absent in O. stangelandi , Fig. 9, but is well-defined in O. hopfferi , Figs 5, 7); (7) DNA COI barcode 6.1% and 4.7% different from that of O. hopfferi and O. stangelandi , respectively. Characters (1) and (3) appear to be the most easily observed. The female of O. aureopecta is unknown but may be mostly black similar to females of the other two species.

Discussion.

The description of O. aureopecta adds a fifth species to Oxynetra , and confirms the occurrence of the genus in Mexico. While the damaged paratype specimen in CNIABM has been examined by many researchers, its authenticity has been questioned since it was apparently the only specimen of the genus labeled from Mexico ( De la Maza et al. 1991, Warren 2000). Thus, the discovery of the holotype specimen in the LACM, in much better condition than the paratype-and nearly identical in appearance-confirms the provenance of Oxynetra in Mexico. Based on the known distribution of O. aureopecta in cloud forest habitats of the Sierra Madre Oriental, we suspect that the species might be endemic to Mexico.

However, Oxynetra species remain unknown from Guatemala, El Salvador, Honduras and Nicaragua. Given the rarity of species in the hopfferi group- the only group of the genus thus far known to occur in Mesoamerica, it may be that the genus has merely gone undetected in those countries (significant rearing efforts were necessary to detect the presence of O. stangelandi in northwestern Costa Rica). Therefore, much more fieldwork must be conducted before the overall distributions of Oxynetra species in Mesoamerica can be defined.