Phronia prolongata Salmela

Salmela, Jukka & Kolcsar, Levente-Peter, 2017, New and poorly known Palaearctic fungus gnats (Diptera, Sciaroidea), Biodiversity Data Journal 5, pp. 11760-11760 : 11760

publication ID

https://dx.doi.org/10.3897/BDJ.5.e11760

persistent identifier

https://treatment.plazi.org/id/D6915560-1EB7-0833-50C1-7579E74CE20D

treatment provided by

Biodiversity Data Journal by Pensoft

scientific name

Phronia prolongata Salmela
status

sp. n.

Phronia prolongata Salmela   ZBK sp. n.

Materials

Type status: Holotype. Occurrence: catalogNumber: DIPT-JS-2015-0215 ; recordedBy: E. Rundgren; individualCount: 1; sex: male; Location: country: Finland; stateProvince: Lapponia inarensis; verbatimLocality: Inari, Muotkatunturi Wilderness Area, Kielajoki; verbatimLatitude: 69.146; verbatimLongitude: 26.292; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: J. Salmela; Event: samplingProtocol: Malaise trap; eventDate: 2014-6-26 /8-5; habitat: lush and swampy riparian birch forest; Record Level: institutionCode: ZMUT Type status: Paratype. Occurrence: catalogNumber: MYCFI183-11 ; recordedBy: Finnmarksprosjektet; individualCount: 1; sex: male; Location: country: Norway; stateProvince: Finnmark; verbatimLocality: Alta, Goppaelva; verbatimLatitude: 70.027; verbatimLongitude: 23.394; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: J. Salmela, G. Söli; Event: samplingProtocol: sweep net; eventDate: 2010-6-13; Record Level: institutionCode: NHMO Type status: Paratype. Occurrence: catalogNumber: MYCFI184-11 ; recordedBy: Finnmarksprosjektet; individualCount: 1; sex: male; Location: country: Norway; stateProvince: Finnmark; verbatimLocality: Alta, Goppaelva; verbatimLatitude: 70.027; verbatimLongitude: 23.394; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: J. Salmela, G. Söli; Event: samplingProtocol: sweep net; eventDate: 2010-6-13; Record Level: institutionCode: NHMO Type status: Paratype. Occurrence: catalogNumber: BC-ZSM-DIP-22552-E10 ; recordedBy: D. Doczkal, S. Schmidt & J. Voith; individualCount: 1; sex: male; Location: country: Germany; stateProvince: Bavaria; verbatimLocality: Allgäu, Oberstdorf, Schochen; verbatimElevation: 2032 m; verbatimLatitude: 47.3936; verbatimLongitude: 10.3692; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: J. Salmela; Event: samplingProtocol: Malaise trap; eventDate: 2014-6-6 /21; habitat: Blaugras-Horstseggenrasen; Record Level: institutionCode: ZSM Type status: Other material. Occurrence: catalogNumber: BIOUG21868-H06 ; recordedBy: BIObus; individualCount: 1; sex: female; Location: country: Canada; stateProvince: British Columbia; verbatimLocality: Vancouver Island; verbatimLatitude: 49.044; verbatimLongitude: -125.684; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: BOLD ID engine; Event: samplingProtocol: sweep net; eventDate: 2014-6-30; habitat: old growth temperate rain forest; Record Level: institutionCode: BIOUG

Description

Male. Head brown, vertex covered by pale setae, frons glabrous. Ocelli arranged in a very shallow triangle, central ocellus slightly smaller than laterals; lateral ocelli close to eyes, their distance from eye less than their own width. Eyes pubescent. Palpi brown, bearing light setae. Length ratio of palpal segments 3-5: 3:4=0.92, 4:5=0.62. Penultimate segment 3.51 times as long as wide, last segment 10.0 times as long as wide. Third palpomere with a sensory pit in its base. Antennae brown, 16-segmented (scape, pedicel and 14 flagellomeres). Scape:pedicel length ratio 1.28. Flagellomeres cylindrical, length:width ratio of 1st flagellomere 3.0, 4th flagellomere 2.58 and apical flagellomere 3.2. Flagellomeres covered by dense light setosity, setae slightly curved, their length shorter than width of respective flagellomere.

Thorax generally brown, scutum dorsally dark-brown. Scutum with mainly pale setosity, including the two stout and long dorso-posterior setae above scutellum. Mediotergite bare, other sclerites bearing setae. Scutellum with four stout marginal setae. Halteres pale, bearing weak light setae and setulae.

Wings hyaline, veins light brown. Bases of M1 and M2, M1+2, r-m, bM1+2, bRs and apex of Sc bare, other veins setose. C slightly exceeding tip of R5. Sc ending free. Length ratio of M1+2:r-m = 1.29. Wing length 3.2-3.5 mm.

Coxae and legs yellowish brown, bearing dark setae. Length ratio of femur to tibia for fore and mid legs (hind legs are missing from the holotype, ratios of that leg are form the German paratype): 0.93, 0.9, 0.76. Length ratio of tibia to basitarsus for fore and mid legs: 0.96, 1.21, 1.5. Anteroapical depressed area of the fore tibia ovate, having numerous light setae over the area. Ratio of apical width of tibia:length of longest tibial spur for fore and mid legs: 0.67, 0.33, 0.23.

Abdomen. 9th tergite and cerci as in Fig. 14a. Ventroapical projection of gonocoxites conspicuous, relatively long and narrow (Fig. 14c). Ventral lobe of gonostylus triangular, with a rather long and pointed ventrobasal outgrowth (Fig. 14d). Dorsal lobe of gonostylus relatively short, about 1.6 times longer than basally wide, bearing numerous setae (Fig. 14b, c, d). Mesial portion of gonostylus bearing 13-14 rows of combs, and a finger-like projection that is mostly bare, having an apical comb-row (Fig. 14d). Aedeagus (in lateral view) is evenly curved along its length and parameres are very long, about as long as aedeagus (Fig. 14e, f).

Female. In general, similar to male. Antennae dark except scape, pedicel and base of 1st flagellomere yellowish brown. Scape:pedicel length ratio 1.54. Length:width ratio of 1st flagellomere 3.1, 4th flagellomere 2.14 (apical flagellomeres broken off). Length ratio of M1+2:r-m = 1.58. Wing length 3.5 mm.

Diagnosis

Phronia prolongata sp.n. is a closely related species of P. exigua (Zetterstedt, see Fig. 16). The ventroapical projection of the gonocoxites in the new species is rather long and narrow (shorter and broader in P. exigua ), the aedeagus (in lateral view) is evenly curved along its length (less curved in P. exigua ) and the parameres are very long, about as long as the aedeagus (much shorter in P. exigua , less than 0.5 times the length of the aedeagus).

Etymology

The name (Latin prolongata , an adjective) of the new species refers to the elongated, prolonged parameres of the male hypopygium.

Distribution

The new species has a Holarctic range, it is known from Canada (British Columbia), Norway, Finland and Germany (Fig. 3). Fennoscandian sites are located in the Arctic-Alpine ecoregion and the collecting site in Germany was at high altitude alpine zone.

Ecology

The Finnish collecting site was a swampy riparian birch forest and in Germany the species was collected from an alpine meadow.

Taxon discussion

The new species belongs to a group of species clastered with P. exigua , all sharing a beaked, setose ventral lobe of the gonostylus (ventrobasal outgrowth of the ventral lobe of gonostylus) and a row of ventral setae on the hind tibia ( Gagné 1975). The new species is relatively close to P. egregia Dziedzicki, a species having very wide and apically expanded ventroapical lobe of the gonocoxite (see e.g. Gagné 1975, fig. 14 and Zaitzev 2003, fig. 93.2); this lobe in the new species is rather narrow and apically very slightly expanded (Fig. 14c). The closest relative of the new species is apparently P. exigua , that has a wide ventroapical lobe of the gonocoxite, the aedeagus is not evenly curved and the parameres are short (see Fig. 15; length of paramere:length of aedeagus 0.46, this ratio is 1.0 in P. prolongata sp.n.).

DNA barcoding

BOLD Sample ID: DIPT-JS-2015-0215. BOLD Process ID: SCFI251-15. GenBank accession number: KY062993.

AATTTTATACTTTATTTTTGGTGCTTGATCTGGAATAGTAGGAACTTCCCTAAGAATTATTATTCGTGCTGAACTTGGTCATCCAGGAGCATTGATTGGAAATGATCAAATTTATAATGTAATTGTTACTGCTCATGCTTTCATTATAATTTTTTTTATAGTTATGCCCATTATAATTGGTGGGTTTGGTAACTGACTTGTCCCATTGATATTGGGGGCCCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTCTGATTATTGCCTCCCTCATTAACACTTCTTCTTTCAAGAAGTTTAGTCGAAGCTGGGGCTGGTACAGGTTGAACTGTTTATCCCCCTCTTTCTTCTACTATTGCTCACGCAGGATCTTCTGTTGATCTAGCTATTTTTTCTCTTCATTTAGCTGGTATTTCTTCAATTTTAGGGGCGGTAAATTTTATCACAACTATTATTAATATACGAGCTCCAGGAATTTCCTTTGATCGTTTACCTTTATTTGTTTGATCTGTTCTTATTACTGCTGTATTGCTTCTTTTATCGCTACCAGTTTTAGCTGGGGCTATTACTATACTTTTAACTGATCGAAATTTAAACACATCTTTCTTTGACCCTGCCGGAGGGGGGGACCCTATTCTTTATCAACATTTATTT

The similarity of COI sequences between the new species and P. exigua range between 95.57 and 94.8, and between the new species and P. egregia 89.98-87.86. The new species displays a notable intraspecific variation: the Canadian non-type female has 97.06 similarity compared to the holotype and the two Norwegian specimens have 96.6 similarity. Interestingly the similarity of the holotype and German paratype is 98.94, and these two are classified to the same Barcode index number (BIN) by the BOLD (BOLD:ACW2188), shared by no other specimens. The new species is, however, monophyletic (Fig. 16) and despite COI divergences, we find all the studied male specimens conspecific. For example, biting midges ( Ceratopogonidae ) Brachypogon sociabilis (Goetghebuer) and Bezzia rhynchostylata Remm in Finnmark, Norway, were characterised by relatively high intraspecific distances (4.0-3.8 %) and were classified to four and three BINs, respectively ( Stur and Borkent 2014). Despite this variation, the specimens had no observable morphological differences and were considered conspecific. DNA barcode and associated data of the German paratype and Canadian female specimen are available from the BOLD Public data portal.

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Diptera

Family

Mycetophilidae

Genus

Phronia