Boletina norokorpii Salmela & Kolcsar
publication ID |
https://dx.doi.org/10.3897/BDJ.5.e11760 |
persistent identifier |
https://treatment.plazi.org/id/DCE0F068-CAE2-1BE1-95D1-3370563D4788 |
treatment provided by |
|
scientific name |
Boletina norokorpii Salmela & Kolcsar |
status |
sp. n. |
Boletina norokorpii Salmela & Kolcsar ZBK sp. n.
Materials
Type status: Holotype. Occurrence: catalogNumber: DIPT-JS-2016-0044 ; recordedBy: J. Salmela; individualCount: 1; sex: male; Location: country: Finland; stateProvince: Ostrobothnia borealis pars borealis; verbatimLocality: Ylitornio, Tuorerommas Mire Conservation Area; verbatimLatitude: 66.479; verbatimLongitude: 24.757; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: J. Salmela; Event: samplingProtocol: Malaise trap; eventDate: 2012-7-2 /8-6; habitat: old-growth boreal forest with a spring brook; Record Level: institutionCode: ZMUT
Description
Male. Head black, vertex covered by pale setae, frons glabrous and face with scattered setae. Ocelli in a shallow triangle, median ocellus smallest. Clypeus not much longer than wide (about 1.2 times longer than basally wide). Scape and pedicel brownish, first and second flagellomeres yellowish, base of third flagellomere yellowish. Length ratio of pedicel:first flagellomere 0.36. Flagellomeres dark, palpus yellow.
Thorax dark-brown with pale setosity. Antepronotum yellow. Halter yellow. Femora yellow, bearing pale setae. Trochanters infuscated. Femora yellow. Legs gradually darkening toward tarsi. Tibial spurs brownish. Length ratio of femur to tibia for fore and hind legs: 0.93, 0.76. Length ratio of tibia to basitarsus of hind leg: 1.68.
Apex of wing slightly infuscated. Bases of M1 and M2, M1+2, r-m, bM1+2, Rs, A1 and Sc bare, other veins setose. C exceeding tip of R5 16 % of the distance between R5 and M1. Sc ending in C at the level of Rs. Sc2 present. Length ratio of M1+2:r-m = 1.14. Cu forking slightly beyond M end of r-m. Wing length 4.1 mm.
Abdomen dark-brown, tergites 2-4 laterodistally yellowish. 9th tergite elongated; cerci bearing two rows of combs, that are about equally wide, having 18 stout setae (Fig. 9b). Ventral lobes of gonocoxites laterally rugose, basally with pale setosity, apices bare (Fig. 9a). Dorsal lobe of gonostylus with setosity, apical beak relatively strong, pointed and bearing minute setulae (Fig. 9c). Ventral lobe of gonostylus with no stout setae, evenly curved in lateral view (Fig. 9c). Apices of parameres without horns (Fig. 9d, e).
Diagnosis
A species very close to B. curta and B. sasakawai sp.n. The ventral lobe of the gonostylus of B. norokorpii sp.n. is curved, having no stout setae (setae present in B. curta ; ventral lobe of the gonostylus in B. sasakawai sp.n. is sinuous). The caudal and proximal combs of the cerci are equally wide, having relatively a small number (18) of stout setae (over 40 in both B. curta and B. sasakawai sp.n.)
Etymology
The new species is named after Dr. Yrjö Norokorpi, Finnish forest researcher and former area manager at Parks & Wildlife Finland. The name is a genitive.
Distribution
So far known from SW Finnish Lapland only (Fig. 5).
Ecology
The Finnish trapping site was an old-growth boreal forest characterised by vascular plants typical for base-rich soils, such as Paris quadrifolia and Calypso bulbosa.
Taxon discussion
The new species is very close to the eastern Palaearctic species B. curta and B. sasakawai sp.n. It is likely, however, that the eastern species are more related to each other than to B. norokorpii sp.n. For example, presence of Sc2 (absent in other species), shorter basal flagellar segments (1st flagellomere about 2.4 times longer than pedicel; in other species 3.1-4.2) and the small number (18; over 40 in other species) of stout setae of combs in the cerci separate the new species from the eastern Palaearctic taxa. We assume that both eastern Palaearctic species have restricted ranges in Japan, Far East Russia and neighbouring areas, whereas B. norokorpii sp.n. might have a widespread boreal range.
DNA barcoding
Holotype: BOLD Sample ID: DIPT-JS-2016-0044. BOLD Process ID: SCFI744-16. GenBank accession number: KY062991.
AATATTATATTTTATTTTTGGAGCTTGATCAGGAATAATTGGTACATCATTAAGAATTCTTATTCGTGCTGAATTAGGACACCCTGGAGCATTAATTGGAGATGATCAAATTTATAATGTTATTGTAACAGCTCATGCATTTGTAATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAATCCCTTTAATATTAGGAGCTCCTGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGACTACTTCCTCCTTCATTAATATTACTTTTATCCAGAAGTTTAGTTGAAACAGGGGCTGGTACAGGTTGAACAGTGTACCCACCATTATCCTCAACAATTGCTCATGCAGGAGCATCTGTTGATTTAGCAATTTTTTCATTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCTGTAAATTTTATTACTACAATTATTAATATACGAGCTCCTGGAATTACTTTTGAACGAATACCTCTTTTTGTATGATCAGTTTTAATTACAGCTATTTTATTATTATTATCTCTCCCAGTTTTAGCTGGAGCTATTACTATACTTTTAACAGACCGTAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACACTTATTC
The new species is assigned to the BIN BOLD:ADD1952, shared by no other specimens. In BOLD database the closest matches to this specimen are three Boletina lundbecki Lundström and four Boletina unassigned to taxonomic species (93,43 - 93,02 similarity).
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |