Anacharis martinae Vogel, Forshage & Peters, 2024

Vogel, Jonathan, Forshage, Mattias, Bartsch, Saskia B., Ankermann, Anne, Mayer, Christoph, von Falkenhausen, Pia, Rduch, Vera, Müller, Björn, Braun, Christoph, Krammer, Hans-Joachim & Peters, Ralph S., 2024, Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species, Journal of Hymenoptera Research 97, pp. 621-698 : 621-698

Anacharis martinae Vogel, Forshage & Peters sp. nov.

Figs 2 F , 3 C , 12 A – E

Diagnosis

(n = 18). Belongs to the eucharioides species group. Medium sized species (2.6–3.3, mean 2.9 mm, similar to A. eucharioides , A. petiolata and A. typica ). Different from A. petiolata and A. typica in having a centrally carinate mesoscutellum (Fig. 12 D , centrally smooth in A. petiolata and A. typica ). Different from A. eucharioides by having oblique carinae on the lateromedial area of the pronotum (Fig. 12 B ). This character is shared with A. belizini , which is an Indomalayan species described from Thailand. Anacharis martinae differs from A. belizini by having a larger glabrous area on the clypeus medioventrally (largely pubescent in A. belizini ) (Fig. 12 C ) and a brown to dark-brown metasoma (black in A. belizini ) (Fig. 12 A ). WIPs: The band pattern of the fore wings reaching along about half the length of the non-sclerotised vein M (Fig. 2 C , reaching along at least 2 / 3 the length of the non-sclerotised vein M in all other species, including those of the immunis species group). The apical spot of the hind wing fills almost the entire apical area (Fig. 2 C , filling about half the apical area in other species of the eucharioides species group).

Description.

Both sexes. Size. Body: ♀ 2.6–3.2 (3.2) mm, ♂ 2.3–2.9 mm. Antennae: ♀ 1.7–2.3 (2.1) mm, ♂ 2–2.3 mm. Fore wing: 2.1–2.8 (2.5) mm

Colour. Body black to reddish-brown (Fig. 12 A ); base of scape usually (Fig. 12 A, C ), head always (Fig. 12 A, C ), base of mandibles usually (Fig. 12 C ), mesosoma usually (Fig. 12 A, B, D, E ), coxa to a varying degree (Fig. 12 A ), hind-trochanter usually basally, and petiole usually black (Fig. 12 A ); scape usally apically (Fig. 12 C ), rest of antennae (Fig. 12 A ), tegulae (Fig. 12 B, D ) and metasoma brown (Fig. 12 A ); mandibles & palps (Fig. 12 C ) and rest of legs (Fig. 12 A ) testaceous.

Head. Roundish-trapezoid in frontal view, genae gently kinked, in an angle <90 ° to the vertical axis of the face (Fig. 12 C ); lower face with thick silvery hairs, densely punctured (Fig. 12 C ); clypeal margin bilobed, somewhat flanged upwards, clypeus otherwise convex, medioventrally smooth, otherwise punctate (Fig. 12 C ); malar area with coriaceous texture, reaching from ventral eye margin along entire stretch of mandibular base (Fig. 18 B ), anteroventral corner of mandibular base sometimes smooth; genae smooth around eye, with increasingly dense punctation and regular setae towards the hind margin; upper face with somewhat thinner setae, punctured, with usually shallow median dent; space between toruli sometimes transversally striolate, intertorular distance: torulus to eye distance 1.4–2.0 (1.9); eyes with scattered setae, extent varying (Fig. 12 C ); POL: OOL: LOL: OD 2.4–2.8 (2.6): 1.2–2.1 (1.3): 1–1.4 (1.2): 1, POL: petiole length 0.45–0.75 (0.59); vertex pubescent between lateral ocellus and compound eye, small glabrous area anterior of median ocellus reaching until median dent of upper face; head in dorsal view 1.9–2.5 (2.3) times wider than long, laterally longer than medially; vertex and occiput sometimes with shallow and smooth median furrow, occiput with transverse striae (Fig. 12 D ), interrupted medially by furrow if present.

Antennae. ♀ formula:

1.9–2.3 (2.1): 1: 2.1–2.8 (2.5): 1.6–2.1 (2.0): 1.4–2 (1.8): 1.3–1.9 (1.8): 1.3–1.7 (1.6): 1.3–1.6 (1.6): 1.3–1.7 (1.5): 1.3–1.6 (1.4): 1.1–1.5 (1.4): 1.1–1.5 (1.4): 2.1–2.5 (2.3)

♂ formula:

1.6–2.7: 1: 2 – 2.9: 1.6 – 2.5: 1.4 – 2.3: 1.3 – 2: 1.3 – 1.9: 1.3 – 2.1: 1.3 – 2: 1.3 – 2: 1.1 – 2: 1.1 – 2: 1.3 – 2

Mesosoma. Mesosoma 1.3–1.4 (1.4) times longer than high (Fig. 12 B ); pronotal plate variable in sculpture, usually smooth with some few radial carinae; pronotum laterally setose, with longitudinal carinae along entire stretch reaching the posterior margin (Fig. 12 B ), sometimes somewhat branching; mesopleuron without coriaceous texture, rugulose anteroventrally, setose anteroventrally and along ventral margin, otherwise glabrous (Fig. 12 B ); mesopleural line merging with posteroventral hypocoxal furrow, ventral margin somewhat continuous, dorsally marked by influent striae (Fig. 12 B ); mesopleural triangle separated from mesopleuron by carina that fades before reaching the posterior subalar pit, posterodorsally smooth and shiny; axillulae well delimited (Fig. 12 B ), inside setose and longitudinally striate; mesoscutum 1.0–1.2 (1.1) times wider than long and 1.3–1.5 (1.4) times longer than the mesoscutellum (Fig. 12 D ); notauli distinct, sometimes deep, with weak or strong transversal carination inside that is less dense than in A. eucharioides , usually surrounded by weak to strong wrinkles (Fig. 12 D ); median lobe of mesoscutum setose, gradually weakening towards posterior end (Fig. 12 D ), lateral lobes denser setose along outer margins than along inner margins; mesoscutellar foveae sometimes each delimited by a circumfoveal carina (Fig. 12 D ), which is sometimes not fusing with median carina; median carina sometimes extending over entire dorsal surface of mesoscutellum (Fig. 12 D ), sometimes interrupted, rarely completely absent, usually accompanied by lateral carinae that are less distinct but are not prone to disappear among general reticulate inside (as in A. eucharioides ); posterior surface of mesoscutellum medially broadly raised (Fig. 12 E ), evenly setose, with one, two or more (sub-) median longitudinal carinae (Fig. 12 E ), rarely branching, laterally smooth to reticulate; dorsal axillular area laterally rugose to striate (Fig. 12 D – E ); sculpture of propodeum variable; nuchal collar usually with a narrow tooth dorsomedially (Figs 6 C , 12 E ).

Wings. Marginal cell of fore wing 2.5–2.8 (2.6) times longer than wide (Fig. 2 C ). WIPs (Fig. 2 C ): Purple band pattern of fore wing reaching along about half the length of vein M. Apical spot of hind wing large, filling almost entire apical area.

Metasoma. 0.9–1.2 (1.2) times longer than rest of body (Fig. 12 A ); gaster 2.1–2.4 (2.4) times longer than petiole (Fig. 12 A ); petiole 1.0–1.6 (1.4) times longer than hind coxa (Fig. 12 A ); metasomal tergite 2 (T 2) with 0–4 (2) lateral setae on each side, with irregular punctures, T 3-4 with narrow bands of punctures, dorsally usually interrupted, T 5 with broad band of punctures, decreasing in width on T 6-7, T 7 with few setae along the band and more setae in posterior half than in the anterior half.

Male genitalia. Parameral plate submedially widened, basoventral margin rounded, without tooth.

Males. Flagellomeres dorsoventrally bicoloured yellow-dark brown, gaster shorter than in females. T 7 in males almost entirely punctured except medially, long setae across surface, except on smooth area.

Variation.

The specimens from the Bavarian Forest National Park ( BC- ZSM -HYM-27596 -F 10 & BC- ZSM -HYM-27596 -F 09 ) are in colouration similar to the holotype (Fig. 12 ), but more distinct, i. e. the head is distinctly darker than the rest of the body. They are also smaller than the average. ZFMK -TIS-2640713 has a strong sculpture on its pronotal plate, whilst other specimens are rather smooth and of weaker sculpture. ZFMK -TIS-2640791 has a completely smooth dorsal surface of the meso-scutellum but fits otherwise well within the species morphologically.

CO 1 barcode.

n = 18. Maximum intraspecific distance = 2.3 %. Minimum distance to closest species ( A. eucharioides ) = 7.9 %. CO 1 barcode consensus sequence:

AATTTTATACTTTATTTTAGGTATTTGATCAGGAATAATAGGATCAAGATTAAGAATAATTATTCGAAT AGAATTAGGAACCCCATCTCAATTAATCATAAATGATCAAATTTATAACTCAATTGTAACTGCTCATGCA TTTATTATAATTTTTTTTATAGTAATACCAATTATAGTAGGAGGATTTGGAAATTATCTGGTTCCTCTAA TACTAATTTCTCCTGATATAGCCTTCCCACGATTAAATAATTTAAGATTTTGATTTTTAATCCCATCCCT ATTTTTAATAACAATAAATTTATTTATTGATCAAGGAGCTGGTACAGGATGAACTGTATACCCTCCACTA TCCTCCTTAACGGGTCATCCATCAATATCAGTAGATTTAGTTATTTATTCTCTTCATTTAAGAGGAATTT CTTCAATTCTTGGTTCAATTAATTTTATTGTAACAATTTTAAATATACGAATAAACTCAATAACAATAGA TAAAATTTCATTATTCATTTGATCTATTTTTTTAACAACTATTTTACTATTATTATCATTACCTGTATTA GCTGGAGGTTTAACAATATTACTTTTTGATCGAAACTTAAATACATCATTTTTTGATCCTACAGGAGGAG GAGACCCAATTTTATATCAACATTTATTT

Type material.

Holotype. Germany • ♀; Hesse, Waldeck-Frankenberg, National park Kellerwald-Edersee, Banfehaus , old floodplain of the Banfe; 51.167 ° N, 8.9749 ° E; ca 270 m a. s. l.; 22 Jul. - 5 Aug. 2021; GBOL III leg.; Malaise trap (Krefeld version); ZFMK -TIS-2640787 .

Paratypes. Germany • 2 ♂♂; same collection data as for holotype; ZFMK -TIS-2640788 , ZFMK -TIS-2640791 . • 1 ♂; Bavaria, Bavarian Forest National Park ; 48.937 ° N, 13.42 ° E; ca 830 m a. s. l.; 1 Jun. 2013; BC- ZSM -HYM-27764 -H 01 ( ZSM) . • 1 ♀, 1 ♂; Bavaria, Bavarian Forest National Park ; 49.099 ° N, 13.233 ° E; ca 710 m a. s. l.; 1 Jun. 2013; female - BC- ZSM -HYM-27596 -F 10 ( ZSM); male - BC- ZSM -HYM-27596 -F 09 ( ZSM) . • 1 ♂; Bavaria, Garmisch-Partenkirchen, Zugspitze , mountain; 47.4062 ° N, 11.0095 ° E; ca 1970 m a. s. l.; 20 Jun. - 5 Jul. 2018; Doczkal, D., Voith, J. leg.; Malaise trap; ZFMK -TIS-2637892 ( NHMUK) . • 1 ♂; Hesse, Gießen, Hohberg, Großen-Buseck ; 50.6196 ° N, 8.7844 ° E; ca 300 m a. s. l.; 17 Jun. 2021; GBOL III leg.; sweep net; ZFMK -TIS-2629493 . • 1 ♂; Hesse, Rheingau-Taunus, Lorch am Rhein, above Nollig castle ; 50.0495 ° N, 7.7966 ° E; ca 250 m a. s. l.; 17–25 Jun. 2015; Niehuis, Oliver leg.; Malaise trap; MF 3; ZFMK -TIS-2628231 . • 1 ♀, 2 ♂♂; Hesse, Waldeck-Frankenberg, National park Kellerwald-Edersee, Maierwiesen ; 51.1555 ° N, 9.0015 ° E; ca 370 m a. s. l.; 22 Jun. - 8 Jul. 2021; GBOL III leg.; Malaise trap (Krefeld version); female - ZFMK -TIS-2640809 ( NHRS); males - ZFMK -TIS-2640804 , ZFMK -TIS-2640805 ( NHRS) . • 1 ♀; Hesse, Waldeck-Frankenberg, NP Kellerwald-Edersee, „ Banfe-Haus “; 51.167 ° N, 8.9749 ° E; ca 270 m a. s. l.; 7–21 Jul. 2022; GBOL III leg.; Malaise trap; ZFMK -TIS-2640770 . • 1 ♀; Hesse, Waldeck-Frankenberg, NP Kellerwald-Edersee, „ Große Küche “; 51.1564 ° N, 8.9879 ° E; ca 320 m a. s. l.; 19 Aug. - 2 Sep. 2021; GBOL III leg.; Malaise trap; ZFMK -TIS-2640690 ( NHMUK) . • 1 ♀, 2 ♂♂; Hesse, Waldeck-Frankenberg, NP Kellerwald-Edersee, „ Maierwiesen “; 51.1555 ° N, 9.0015 ° E; ca 370 m a. s. l.; 8–22 Jul. 2021; GBOL III leg.; Malaise trap; female - ZFMK -TIS-2640734 ( SMNS); males - ZFMK -TIS-2640731 , ZFMK -TIS-2640733 ( SMNS) . • 1 ♀; Rhineland-Palatinate, Ahrweiler, Niederzissen, Bausenberg , upper part of volcanic mountain, next to oak tree; 50.4672 ° N, 7.2212 ° E; ca 310 m a. s. l.; 26 May- 12 Jun. 2022; Jaume-Schinkel, Santiago leg.; Gressit Malaise trap; ZFMK -TIS-2640713 .

Other material examined.

Without DNA barcode. Belgium • 1 ♀; Walloon Region, Namur, Nismes ; 50.0744 ° N, 4.5556 ° E; ca 220 m a. s. l.; 10 Jul. 2022; W. Declercq leg.; Light trap; ZFMK -HYM-00039668 ( RBINS) . • 1 ♀; Walloon Region, Tellin, Ri d’Howisse ; 50.1113 ° N, 5.2531 ° E; ca 260 m a. s. l.; 18 Jul. 2022; W. Declercq leg.; Light trap; ZFMK -HYM-00039667 ( RBINS) .

France • 1 ♂; Bitche; 7 Aug. 1979; Henk J. Vlug leg.; sweep net; specimen in coll MF .

Sweden • 1 ♂; Hälsingland, Skog sn, Noran ; 5 Aug. 1949; Olov Lundblad leg.; NHRS - HEVA 000023178 ( NHRS) . • 1 ♂; Scania, Ystad kommun, Sandhammaren, Järahusen , oak shrub forest on coastal sand dunes; 55.4038 ° N, 14.1999 ° E; ca 10 m a. s. l.; 22 May- 15 Jul. 2005; Swedish Malaise Trap Project ( Swedish Museum of Natural History ) leg.; Malaise trap; NHRS - HEVA 000023179 ( NHRS) .

Switzerland • 1 ♂; Neuchâtel, Auvernier; 8 Aug. 1957; Jacques de Beaumont leg.; specimen at MHNG . • 1 ♀; same collection data as for preceding 15 Aug. 1956; specimen at MHNG .

Biology.

Summer species, flying mainly from June to September, peak in July. No clear preferences in terms of habitat.

Distribution.

Belgium, France, Germany (locus typicus : Kellerwald-Edersee National Park, Banfehaus), Sweden, Switzerland.

No DNA barcode matches with publicly available sequences from other countries.

Mainly collected in lowlands below 400 m a. s. l., occasionally found in higher altitudes at 700–900 m a. s. l. and rarely even higher.

Etymology.

Named after the first author’s wife, Martina Vogel.

Remarks.

In the molecular analysis, A. martinae is split into two clades by ASAP. The gap between the two clusters is 2.3 % and cannot be attributed to poor quality sequences. As ASAP is the only analysis to split this cluster by that gap and we cannot find morphological evidence for a split into two species, we regard this result as an oversplit.

The diagnosis against A. belizini is based on the description and the accompanying SEM images of the holotype in Mata-Casanova et al. (2018). There, A. belizini is described as having a smooth occiput. In the SEM images, however, we can see occipital striolation or striation, which would match with the diagnosis of the eucharioides species group. In Mata-Casanova et al. (2018), A. belizini is said to be most similar to A. antennata , while we think that A. antennata is much closer morphologically to A. petiolata / typica based on the SEM images provided, showing the interrupted mesopleural line, the smooth mesoscutellum and the smooth to rugose lateromedial area of the pronotum.

On the SEM images of A. belizini , the pronotal plate is significantly laterally projecting in dorsal view (Fig. 3 . C. in Mata-Casanova et al. (2018) vs. Fig. 12 D ). This is not the case in A. martinae , and shape of the pronotal plate could be another diagnostic feature to separate A. belizini and A. martinae . Additionally, the parascutal sulcus seems very strongly impressed and carinate in A. belizini , much more so than in any of our specimens of A. martinae (Fig. 12 B ). As we discussed in the treatment of A. eucharioides , the parascutal sulcus is very variable and cannot be used as a diagnostic character. If such extremes as present in A. belizini are consistent or not is currently impossible to evaluate because there is only a single specimen (the holotype) known for A. belizini .

The morphometric analysis (Fig. 8 B ) revealed overlap with the remaining species of the eucharioides species group. However, the morphospace overlaps only partially, which allows us to make statements of inclusive and exclusive ranges in the two ratios extracted as separating species best. The intertorular distance: torulus to eye distance (Fig. 8 B , right) ranges from 1.4 to 2.0, but no other species than A. martinae has a ratio of higher than 1.7, making> 1.7 to 2.0 the exclusive A. martinae range. For POL: petiole length, a ratio of> 0.7 is exclusive for A. martinae , but any ratio below could be other species. While we included the ratios in the description of the species, we refrained from including them in the diagnosis. This partial separation between A. martinae and the remaining species in the morphometric analyses again highlights the morphometric variability of the species in Anacharis (see also remarks on A. eucharioides ) but also points towards the potential power of morphometric analyses which will prove helpful in delimitation of another species ( A. maxima , see below).

Figures

Figure 2. Fore and hind wings of different species of Anacharis showing the WIPs A A. ensifer stat. rev. male (ZFMK - TIS- 2629206) B A. immunis male (ZFMK - TIS- 2629539) C A. martinae sp. nov. female holotype (ZFMK - TIS- 2640787) D A. typica stat. rev. female (ZFMK - TIS- 2640857) E A. maxima sp. nov. male paratype (ZFMK - TIS- 2640676) F A. petiolata stat. rev. female (ZFMK - TIS- 2629285) G A. eucharioides male (ZFMK - TIS- 2629201).

Figure 3. Comparison of Anacharis male genitalia in ventral view A A. ensifer stat. rev. (ZFMK - TIS- 2629209) B A. immunis (ZFMK - TIS- 2629539) C A. martinae sp. nov. male paratype (ZFMK - TIS- 2640733) D A. typica stat. rev. (ZFMK - TIS- 2640757) E A. maxima sp. nov., male paratype (ZFMK - TIS- 2640741) F A. eucharioides (ZFMK - TIS- 2629243) A, B, F were dissected prior to DNA lysis C, D, E after lysis.

Figure 6. Variation of the nuchal collar within the two species groups A bilobed B confluent with median carina of propodeum C dorsomedial narrow tooth (as typical but not exclusive for A. martinae sp. nov.) D broad projection E blunt tooth F broad and high projection.

Figure 8. The PCA plot (left) and lda extractor plot (right) of A A. eucharioides against the rest of the eucharioides species group B A. martinae sp. nov. against the rest of the eucharioides species group C A. maxima sp. nov. against the rest of the eucharioides species group.

Figure 12. Anacharis martinae sp. nov., holotype, female (ZFMK - TIS- 2640787) A lateral habitus B mesosoma lateral C face frontal D mesoscutum and mesoscutellum dorsal E mesosoma posterior view.

Figure 18. (postero-) dorsal view of the head A occiput smooth (A. immunis, ♀, ZFMK - TIS- 2640709) B occiput striate (A. martinae sp. nov., holotype (ZFMK - TIS- 2640787), ♀).