Latouchia jinyun Hao, Yu & Zhang, 2025

Hao, Long, Yu, Kun & Zhang, Feng, 2025, Description of five new species from southern China, with note on the type species of Latouchia Pocock, 1901 (Araneae, Halonoproctidae), Biodiversity Data Journal 13, pp. e 137852-e 137852 : e137852-

Latouchia jinyun Hao, Yu & Zhang sp. nov.

Materials

Type status: Holotype. Occurrence: recordedBy: K. Yu & Y. Lin; sex: male; occurrenceID: 60E01C35-E504-57A5-8908-8818E31D1003; Taxon: scientificName: Latouchia jinyun sp. nov.; Location: country: China; stateProvince: Chongqing; county: Beibei; locality: Jinyun Mountain National Nature Reserve ; verbatimElevation: 251 m; verbatimCoordinates: 29.8271 ° N, 106.4307 ° E; Identification: identifiedBy: L. Hao; Event: eventDate: 11 January 2016; Record Level: institutionCode: MHBU-ARA- 10000049; KYUARA # 1979

Type status: Paratype. Occurrence: recordedBy: K. Yu & Y. Lin; sex: female; occurrenceID: 979CB733-578E-51DA-88C0-8F1E29C24FE1; Taxon: scientificName: Latouchia jinyun sp. nov.; Location: country: China; stateProvince: Chongqing; county: Beibei; locality: Jinyun Mountain National Nature Reserve ; verbatimElevation: 251 m; verbatimCoordinates: 29.8271 ° N, 106.4307 ° E; Identification: identifiedBy: L. Hao; Event: eventDate: 11 January 2016; Record Level: institutionCode: MHBU-ARA- 10000051; KYUARA # 2173

Type status: Paratype. Occurrence: recordedBy: Z. Li & Z. Yang; sex: female; occurrenceID: 4B02C25E-B0AA-519C-893F-81494D739F16; Taxon: scientificName: Latouchia jinyun sp. nov.; Location: country: China; stateProvince: Chongqing; county: Beibei; locality: Jinyun Mountain National Nature Reserve ; verbatimElevation: 376 m; verbatimCoordinates: 29.8382 ° N, 106.4014 ° E; Identification: identifiedBy: L. Hao; Event: eventDate: 12 May 2023; Record Level: institutionCode: MHBU-ARA- 10000050; KYUARA # 1980

Description

Male (Holotype, MHBU-ARA- 10000049). Colouration in ethanol (Fig. 5 A). Carapace and chelicerae dark yellow, with eye mound, fovea and outer edge of carapace darker. Legs similar in colour to carapace, with femora gradually transitioning to slightly deeper hue from proximal to distal, darker than rest of legs. Opisthosoma: Dorsal side brownish-grey, with horizontal dark pattern; ventral side yellowish; booklung covers yellower than rest of ventral areas (Fig. 5 C). Colour difference between sigilla and rest of sternum unconspicuous.

Total length 11.15. Carapace 5.06 long, 4.78 wide; opisthosoma 6.07 long, 3.98 wide. Eye group 0.61 long, 0.44 wide anteriorly, 0.67 wide posteriorly; MOA 0.42 long, front width 0.25, back width 0.41. Eye diameters and interdistance: AME 0.12, ALE 0.30, PME 0.13, PLE 0.25, AME – AME 0.12, AME – ALE 0.14, ALE – PLE 0.15, PME – PME 0.29, PME – PLE 0.03. Palpal coxa 1.72 long, 0.91 wide, without spinule on prolateral-proximal corner. Sternum 3.03 long, 2.75 wide. Labium 0.56 long, 0.99 wide, without cuspule or spinule. Chelicerae without stridulatory ridges; rastellum of left and right chelicerae carries 10 and nine stout spines, respectively; chelicerae groove with 5 / 4 and 3 / 3 teeth of different sizes on promargin and retromargin, respectively.

Leg formula 4123; measurements: I 12.71 (2.46, 2.11, 3.30, 3.02, 1.82), II 11.36 (2.45, 1.94, 2.61, 2.80, 1.56), III 11.22 (3.34, 1.37, 1.69, 2.68, 2.14), IV 14.74 (4.18, 2.03, 3.46, 3.26, 1.81). Spines on femora to metatarsi of legs I – II straight, sword-like (typical); strong spines on the prolateral patellae of leg II, none on leg I, both ventrally with few typical; spines on prolateral tibiae of legs I – II often short, straight, mostly with hooked tip, much more numerous and stouter on leg II than leg I, ventrally more elongate on both legs, either straight or slightly curved (Fig. 6 D and Fig. 16 d ). Tarsi I – IV spineless. Spination of leg I, patellae, Drv (2) / (1), Dpd (0) / (1); Dpv (1) / (2); tibiae, Dp (1-2) / (1-1 - 1 - 2), pv (2-1 - 2 - 2) / (1-1 - 1 - 1 - 3 - 1), rv (1-1 - 1 - 1 - 2) / (1-1 - 1 - 2 - 1); metatarsi, Dpv (1-1) / (1-1), rl (1-1 - 1) / (1-1 - 1 - 1). Spination of leg II, patellae, Dpd (2) / (1), Dpv (1) / (1); tibiae, pl (1-3 - 1 - 2 - 2 - 2 - 1 - 1 - 1 - 1) / (1-2 - 2 - 3 - 3 - 2 - 2), pv (1-1 - 1 - 1 - 1 - 3) / (1-1 - 1 - 1 - 1 - 3), rv (1-1 - 1 - 1) / (1-1 - 1); metatarsi, Mp (1-2) / (1), Dpv (1) / (1), rv (2-1 - 1 - 1) / (1-1 - 1 - 1). Tibia III unmodified, without demi-saddle shape. Trichobothria of legs present on proximal one-third part of tibiae I – III, proximal one – fourth part of tibia IV, distal half of metatarsi I – III, distal two-thirds part of metatarsus IV and dorsal side of all tarsi; trichobothria on tibiae I – IV and metatarsi I – IV unmodified; trichobothria on tarsi divided into unmodified and clavate forms, with former irregularly distributed across almost entire dorsal surface and latter only present in proximal half. Count of trichobothria on legs: I, tibia 4 / 5 pd and 4 / 5 rd, metatarsus 7 / 7, tarsus 14 / 19 unmodified and 5 / 5 clavate; II, tibia 5 / 5 pd and 6 / 5 rd, metatarsus 8 / 7, tarsus 16 / 11 unmodified and 3 / 3 clavate; III, tibia 5 / 5 pd and 5 / 4 rd, metatarsus 6 / 7, tarsus 15 / 14 unmodified and 3 / 5 clavate; IV, tibia 5 / 5 pd and 6 / 6 rd, metatarsus 7 / 6, tarsus 10 / 8 unmodified and 2 / 1 clavate. Tarsal claws: paired claws with five teeth in different sizes on tarsi I – IV (Fig. 6 F); unpaired claw of tarsus I split into two branches; tarsi II – IV unpaired claw bare, without denticle.

Palp 6.48 long (2.41, 1.20, 1.97, 0.90). Trichobothria on palpal tibia unmodified, present on proximal one-third part, on cymbium divided into unmodified and clavate forms, with latter occupying majority of trichobothrial area, while former sparsely distributed at distal end of trichobothrial area; count of trichobothria: tibia 3 / 3 pd, 3 / 3 rd, cymbium 5 / 4 unmodified and 4 / 6 clavate. Tibia tubby, slightly diminution from proximal to distal, with one lyriform organ on ventro-prolateral side of sub-distal part; tibia lacks spine or spinule (Fig. 5 E – F). Palpal organ: tegulum oval (Fig. 5 G); embolus long, approximately 1.5 times the width of tegulum, the distal one-third portion of the embolus is obviously bent, forming the embolus into a hook-shaped structure, with one transparent elevated embolic keel extending from distal one-fourth of embolus to apex; apex of embolus with retrolateral superior keel and prolateral superior keel (Fig. 5 H and Fig. 6 B).

Female (Paratype, MHBU-ARA- 10000050). Colouration in ethanol (Fig. 5 B). Carapace darker than male, eye mound and fovea dark; area between eye mound and fovea with two slightly lighter longitudinal colour patches; chelicerae similar in colour to carapace. Colour between palp and each leg without significant difference, overall similar in colour to carapace. Opisthosoma: dorsal side as in male; ventral side brighter than dorsal side (Fig. 5 D); sigilla slightly darker than rest of sternum; chelicerae ventrally more reddish than male.

Total length 12.97. Carapace 5.53 long, 4.43 wide; opisthosoma 7.43 long, 4.81 wide. Eye group 0.54 long, 0.46 wide anteriorly, 0.60 wide posteriorly; MOA 0.51 long, front width 0.25, back width 0.41. Eye diameters and interdistance: AME 0.15, ALE 0.29, PME 0.15, PLE 0.25, AME – AME 0.12, AME – ALE 0.05, ALE – PLE 0.10, PME – PME 0.29, PME – PLE 0.03, MOA 0.43 long, front width 0.21, back width 0.41. Palpal coxa 1.93 long, 1.23 wide, bearing 44 / 39 cuspules on prolateral-proximal corner. Sternum 3.09 long, 2.83 wide. Labium 0.76 long, 1.16 wide, with two spinules and one cuspule. Chelicerae without stridulatory ridges; rastellum of left and right chelicerae carrying 11 and nine stout spines, respectively; chelicerae groove with 5 / 5 and 3 / 3 teeth of different sizes on promargin and retromargin, respectively.

Leg formula 4123; measurements: I 8.95 (3.25, 1.22, 2.19, 1.27, 1.02), II 8.57 (3.00, 1.57, 1.69, 1.27, 1.04), III 7.54 (2.73, 1.12, 0.93, 1.42, 1.34), IV 15.53 (3.67, 1.58, 2.39, 1.98, 1.74). Spines of legs I – II primarily distributed on p, pd, r and rv of tibia, as well as p, pv, r and rv of metatarsus and tarsus; most spine tips weakly curved downwards, forming slight hook-shape; some spines on rv longer and not curved at tip. Leg III strong; tibia III shortened, without demi-saddle shape. Groups of short spines on apical and prodorsal sides of patella and dorso-lateral side of tibia; metatarsus with spines grouped in dorso-lateral area. Patella with dorso-proximal group of short stiff bristles on leg IV. Trichobothria of legs present on proximal one-third part of tibiae I – IV, distal half of metatarsi I – IV and proximal two-thirds of all tarsi; trichobothria on tibiae I – IV and metatarsi I – IV unmodified; trichobothria on tarsi divided into unmodified and clavate forms, with latter only present in proximal half of tarsus. Count of trichobothria on legs: I, tibia 4 / 4 pd and 5 / 4 rd, metatarsus 7 / 5, tarsus 10 / 11 unmodified and 6 / 6 clavate; II, tibia 5 / 5 pd and 5 / 5 rd, metatarsus 7 / 7, tarsus 10 / 10 unmodified and 5 / 6 clavate; III, tibia 5 / 5 pd and 5 / 6 rd, metatarsus 7 / 6, tarsus 9 / 10 unmodified and 2 / 4 clavate; IV, tibia 7 / 5 pd and 5 / 6 rd, metatarsus 7 / 7, tarsus 9 / 7 unmodified and 1 / 2 clavate. Tarsal claws: all paired claws with one tooth (Fig. 6 E); unpaired claw bare, without denticle. Palp 8.29 long (2.55, 1.72, 1.93, 2.09), spines on palp distributed on p, pv, r and rv of tibia and tarsus; palpal tarsal claw with one basal tooth.

Vulva (Fig. 5 I and Fig. 6 C). Two separate sperm receptacles connected to atrium via slightly outwardly inclined stalk; the distal half of the outer edge of stalk tilts approximately 45 ° towards the body axis.

Diagnosis

The new species can be easily distinguished from the congeners by the following features: in the males, the distal one-third portion of the embolus is obviously bent, forming a hook-shaped structure (Fig. 5 G and Fig. 6 A); in the females, the distal half of the outer edge of the stalk adjacent to the sperm receptacles tilts 45 ° towards the body axis in dorsal view (Fig. 5 I and Fig. 6 C). The arrangement of spines on the prolateral side of male tibia II is similar to that of L. formosensis smithi , but differs in that these spines are relatively straight, with no obvious distal curvature and the distal half of the ventral side of tibia II possesses seven to nine spines (Fig. 6 D), whereas in L. formosensis smithi , the spines on prolateral side of male tibia II exhibits a distinct distal hook-shape and the distal half of the ventral side of tibia II has only one spine (see Tso et al. (2003): fig. 31).

Etymology

The specific epithet is derived from the type locality; noun in apposition.

Distribution

Known only from the type locality of Chongqing, China (Fig. 17 ).

Biology

The burrows of L. jinyun sp. nov. are commonly found on slopes covered with moss along roadsides. The trapdoor is typically composed of a mixture of moss, mud and silk, with few cases of other materials. During a survey conducted in January 2016, many males were found to be overwintering within their burrows, which were covered with trapdoors indistinguishable from those of female.

DNA barcode

AAAGATATTGGAACATTGTATTTAGTTTTTGGGGTGTGATCTGCGATATTAGGAACTGGAATAAGAGTAATTATTCGAACTGAGTTGGGGCAGGTGGGGAGAATATTGGGGGATGATCATTTGTATAACGTAATTGTAACTGCTCATGCTCTTGTTATAATCTTTTTTATAGTTATACCTATTATGATTGGGGGATTTGGAAACTGACTACTACCTTTGATATTAGGAGCGCCTGATATAGCATTTCCTCGAATGAATAATTTAAGATTTTGATTGTTACCTCCTTCTTTGTTTATATTGCTTTTGTCTTCATTAGTGGATACTGGGGTTGGAGCAGGTTGGACTATTTATCCGCCTTTATCTTCAGGATTAGGGCATAGAGGTGGAGGAATAGATTTTGCTATTTTTTCTTTACATTTAGCTGGGGCTTCGTCGATTATAGGTTCTATTAATTTTATTTCTACTATTACTAATATGCGTTCTAATGGAATGGATATAGGGCGTGTGCCTTTATTTGTATGGTCTGTGTTAATTACTACTATTTTATTATTATTATCTTTACCCGTTTTGGCTGGAGCTATCACCATATTATTGACAGATCGGAATTTTAATACTTCATTTTTTGACCCTGCGGGGGGTGGGGATCCAATTTTATTTCAACATTTATTTTGATTTTTTGGTCAC (GenBank accession number: PQ 585639).

Figures

Figure 5. Latouchia jinyun sp. nov. A, C, E – H Holotype male; B, D, I Paratype female. A – D Habitus; E, F Palp; G Palpal bulb; H Distal half of embolus; I Vulva, with arrows indicate stalk tilts approximately 45 ° towards the body axis. In dorsal (A, B, I), ventral (C – E), prolateral (G, H) and retrolateral (F) view.

Figure 6. Latouchia jinyun sp. nov. A, B, D, F Male; C, E. Female. A Palpal bulb; B Distal part of embolus; C Vulva; D Patella and tibia of left leg II, showing the spination; E, F Paired claws of left leg I. In prolateral (A, B, D, E, F) and dorsal (C) view. Abbreviations: A, apical keel; AE, apex of embolus; BE, base of embolus; PS, prolateral superior keel on tip of embolus; RS, retrolateral superior keel on tip of embolus; SR – sperm receptacle; ST – subtegulum; SK – stalk; T – tegulum.

Figure 17. The type localities of Latouchia species of China: L. calcicola sp. nov. (1), L. jinyun sp. nov. (2), L. linmufu sp. nov. (3), L. wenchuan sp. nov. (4), L. yaoi sp. nov. (5), L. cornuta (6), L. wenruni (7), L. yuanjingae (8), L. hunanensis (9), L. rufa (10), L. formosensis (11), L. formosensis smithi (12), L. yejiei (13), L. davidi (14), L. fossoria (15) and L. pavlovi (16). The type locality of L. vinhiensis is uncertain.

Figure 16 d. Latouchia jinyun sp. nov. (1) left leg I, (2) left leg II;