Wahydra graslieae A. Warren, Carneiro & Dolibaina, 2018

Carneiro, Eduardo, Dolibaina, Diego R., Grishin, Nick V. & Warren, Andrew D., 2018, A new species of Wahydra from Ecuador (Hesperiidae, Hesperiinae, Anthoptini), Zootaxa 4392 (1), pp. 196-200 : 197-199

publication ID

https://doi.org/10.11646/zootaxa.4392.1.11

publication LSID

lsid:zoobank.org:pub:E92FF3D8-B86B-4ED4-A074-5B266FE0711B

DOI

https://doi.org/10.5281/zenodo.5973808

persistent identifier

https://treatment.plazi.org/id/EB1F87AC-DB58-FFF4-FF19-A0323DF0D32A

treatment provided by

Plazi

scientific name

Wahydra graslieae A. Warren, Carneiro & Dolibaina
status

sp. nov.

Wahydra graslieae A. Warren, Carneiro & Dolibaina , sp. nov.

( Figs 1–4 View FIGURES 1–2 View FIGURE 3 View FIGURE 4 )

Diagnosis. DFW uniformly brown with a thin tripartite stigma between CuA1–2A. All other species of Wahydra have orange spots on DFW, though reduced in W. ekka ( Evans, 1955) and W. obscura Steinhauser, 1991 . The VHW ground color is ferruginous red, with a metallic silver discal spot and postdiscal band. These features immediately identify W. graslieae , sp. nov. as unique both among the species of Wahydra and all other known members of Anthoptini . Two potentially sympatric species belonging to Moncini , Tigasis viridenex (Weeks, 1901) and Lerema viridis (Bell, 1942) have a somewhat similar VHW, however, they are easily distinguished from W. graslieae , sp. nov. by their greenish ground color and the highly reduced metallic silver markings. In addition, the bifurcated median apophysis of the tegumen of W. graslieae sp. nov. is not found in any known species of Wahydra nor in the somewhat similar T. viridenex and L. viridis . Wahydra nieblensis Steinhauser, 1991 also has a large median apophysis of the tegumen, but without developed bifurcated arms.

Description. Male. Head: Eyes red. Vertex dark brown scattered with red ferruginous scales. Antennae longer than 2/3 length of forewing costa; antennal club short (1/4 shaft), ventral shaft yellowish in basal portion, dark brownish in apical portion; nudum of 14 segments, covering all the apiculus and extended to the club. Palpus quadrate (inner edge equal to transverse width), first and second segments ventrally yellowish, third segment of medium length (around half the length of second segment), cylindrical, dark brown.

Thorax: dorsally and ventrally covered by long brown and red ferruginous scales; midtibiae spined; hindtibiae with two pairs of spurs. Forewing length 13.3 mm. DFW homogeneous brown, with sparse red ferruginous scales on costal area. Stigma black, thin and tripartite, consisting of an elongate portion in CuA1–CuA2, following CuA, slightly angled towards CuA2, and two smaller spots in CuA2–2A, the anterior quadrate, surrounding CuA2, the posterior reduced, drop-shaped, below the anal fold; one subapical hyaline spot in R5–M1; fringe brown. DHW homogeneous brown; fringe brown. VFW ground color dark brown; costal and outer area ferruginous red; CuA2- 2A area paler; subapical hyaline spot as on DFW; fringe as on DFW. VHW ground color red ferruginous, with a metallic silver spot in the inferior half of the discal cell; a postdiscal metallic silver band from Sc+R1 to CuA2, zigzag patterned, and a circular postdiscal spot in CuA2-2A proximally displaced; fringe as on DHW.

Abdomen: dorsally brown; ventrally ferruginous.

Male genitalia: tegumen rectangular, about twice as wide as long, distally narrowed; median apophysis of tegumen bifurcated, longer than fenestra, larger than half of fenestra; lateral apophysis of tegumen symmetrically pointed. Fenestra rectangular longer than wide. Saccus shorter than tegumen, lobed. Uncus as long as tegumen (including its median apophysis), distally narrowed, shallowly bifid, with two short, divergent arms. Gnathos divided and narrow. Valva somewhat ovoid, narrowed distally; harpe triangular, broad, with a narrow, curved and upturned projection, distally serrated and partially covered by several small spines; sacculus, costa and ampulla narrow. Aedeagus longer than valva; coecum short and undifferentiated, distal opening of aedeagus dorsal, anteriorly contiguous with the opening of the ejaculatory bulb; dorsal triangular lateral projections on distal part of aedeagus; no cornutus.

Female. unknown.

DNA barcode.

ACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCCTAAGTTTATTAATTCGTAC AGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCT TTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAATTCCTTTAATAC TAGGTGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGAATATTACCCCCTTCTTTAATA TTACTAGTCTCTAGAAGAATTGTAGAAAATGGTGCAGGAACTGGTTGAACAGTTTACCCCCCCCTTTC ATCTAATATTGCTCATCAAGGATCCTCTGTTGATTTAGCAATCTTTTCTCTTCATTTAGCTGGAATTTCCT CTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAACATATCATTTGATCAAA TACCTTTATTTGTATGATCAGTAGGAATTACAGCTTTACTTTTACTTTTATCATTACCAGTACTAGCTGGA GCCATCACTATACTTTTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGAGATC CAATCTTATATCAACATTTA

Type material. The male holotype of W. graslieae sp. nov. has the following labels: white, handprinted: / ECUADOR: NAPO: / 14 km E of Yanayacu / Biological Station / along Cosanga River / 2400m, 17-June-2004 / Harold Greeney [leg.] / H09-2030, 11:30 hrs. /; white, printed and handprinted: / EC022 / Wahydra / E. Carneiro det. 2015 /; white, printed: / DNA sample ID: / NVG-5287 / c/o Nick Grishin /; red, printed: / HOLOTYPE / Wahydra graslieae / A. Warren, Carneiro & Dolibaina /. The holotype is deposited at MGCL.

Type locality. The holotype of W. graslieae sp. nov. was collected along the edge of secondary flood plain forest dominated by Alnus Mill. and Piper L.

Etymology. We are delighted to name this species in honor of Emily Graslie, Chief Curiosity Correspondent at the Field Museum (Chicago, Illinois, USA), in recognition of her efforts to promote natural history collections through her YouTube channel The Brain Scoop (https://www.youtube.com/user/thebrainscoop).

DNA

Department of Natural Resources, Environment, The Arts and Sport

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Lepidoptera

Family

Hesperiidae

SubFamily

Hesperiinae

Genus

Wahydra

GBIF Dataset (for parent article) Darwin Core Archive (for parent article) View in SIBiLS Plain XML RDF