Giraffa tippelskirchi Matschie, 1898

Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, European Journal of Taxonomy 703, pp. 1-33 : 24

Giraffa tippelskirchi Matschie, 1898

Diagnosis

Faint or strongly stellate form of the patches, absence of occipital horns, seven ES in the UBN2 intron: 48 dA, 209 iCATAATATATTTAATATATTTAATATTTAATAA, 243 T=>A, 318 G =>C, 332 T=>G, 504 A=> C, 623 C=>T

Type material

Lectotype (here designated)

TANZANIA • 1 specimen (skull and skin); Lake Eyasi ; ZMB-084951 .

Distribution

Kenya, Tanzania (lectotype), Zambia.

Remarks

Matschie (1898) mentions two different specimens as syntypes, but the second cannot be found in the collection catalogue and might be considered as lost.