Limax pseudocinereoniger Schilthuizen, Thompson, de Vries, van Peursen, Reisinger, Paterno, Maestri, Marcolungo, Esposti, Delledonne & Njunjic , 2022,

Schilthuizen, Menno, Thompson, Cameron Graham, de Vries, Rick, van Peursen, Anthonie D. P., Paterno, Marta, Maestri, Simone, Marcolongo, Luca, Esposti, Chiara Degli, Delledonne, Massimo & Njunjic, Iva, 2022, A new giant keelback slug of the genus Limax from the Balkans, described by citizen scientists, Biodiversity Data Journal 10, pp. 69685-69685 : 69685

publication ID

https://dx.doi.org/10.3897/BDJ.10.e69685

publication LSID

lsid:zoobank.org:pub:F638D49D-7182-49CC-8406-2F5EE3556E38

persistent identifier

https://treatment.plazi.org/id/3944596F-E524-4EED-97DB-FBA2A028687B

taxon LSID

lsid:zoobank.org:act:3944596F-E524-4EED-97DB-FBA2A028687B

treatment provided by

Biodiversity Data Journal by Pensoft

scientific name

Limax pseudocinereoniger Schilthuizen, Thompson, de Vries, van Peursen, Reisinger, Paterno, Maestri, Marcolungo, Esposti, Delledonne & Njunjic , 2022
status

sp. n.

Limax pseudocinereoniger Schilthuizen, Thompson, de Vries, van Peursen, Reisinger, Paterno, Maestri, Marcolungo, Esposti, Delledonne & Njunjic, 2022 View in CoL sp. n.

Materials

Type status: Holotype. Occurrence : occurrenceDetails: http://www.boldsystems.org/index.php/API_ Public /specimen?ids=TxExDU0122|TxExPR0004|TxExDU0041|TxExDU0112|TxExDU0121; recordNumber: TxExDU0041; recordedBy: Taxon Expeditions participants; individualID: TxExDU0041; individualCount: 1; sex: H; associatedMedia: http://www.boldsystems.org/pics/TXEX/slug_3+1577602544.jpg|http://www.boldsystems.org/pics/TXEX/ Giant _slug+1577607140.JPG|http://www.boldsystems.org/pics/TXEX/slug_3_lateral+1577604939.jpg|http://www.boldsystems.org/pics/TXEX/slug_3_ventral+1577605013.jpg|http://www.boldsystems.org/pics/TXEX/slug_3_dorsal+1577604893.jpg; Taxon : scientificName: Limax pseudocinereoniger; phylum: Mollusca ; class: Gastropoda ; order: Stylommatophora ; family: Limacidae ; genus: Limax; specificEpithet: pseudocinereoniger; Location: country: Montenegro; decimalLatitude: 43.2189; decimalLongitude: 19.1759; Event: eventDate: 18-07-2018; habitat: under rocky overhang; Record Level: institutionCode: Taxon Expeditions B.V.; basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence : occurrenceDetails: http://www.boldsystems.org/index.php/API_ Public /specimen?ids=TxExDU0122|TxExPR0004|TxExDU0041|TxExDU0112|TxExDU0121; recordNumber: TxExDU0122; recordedBy: Menno Schilthuizen ; individualID: TxExDU0122; individualCount: 1; sex: H; associatedMedia: http://www.boldsystems.org/pics/TXEX/slug_4+1577602643.jpg|http://www.boldsystems.org/pics/TXEX/DU0122lateral+1577615238.jpg|http://www.boldsystems.org/pics/TXEX/DU0122ventral+1577615289.jpg|http://www.boldsystems.org/pics/TXEX/slug_4_dorsal+1577605110.jpg|http://www.boldsystems.org/pics/TXEX/DU0122dorsal+1577615162.jpg|http://www.boldsystems.org/pics/TXEX/slug_4_lateral+1577605161.jpg|http://www.boldsystems.org/pics/TXEX/slug_4_ventral+1577605254.jpg; Taxon : scientificName: Limax pseudocinereoniger; phylum: Mollusca ; class: Gastropoda ; order: Stylommatophora ; family: Limacidae ; genus: Limax; specificEpithet: pseudocinereoniger; Location: country: Montenegro; decimalLatitude: 43.169; decimalLongitude: 18.999; Identification: identifiedBy: Menno Schilthuizen; Record Level: institutionCode: Taxon Expeditions B.V.; basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence: occurrenceDetails: http://www.boldsystems.org/index.php/API_ Public /specimen?ids=TxExDU0122|TxExPR0004|TxExDU0041|TxExDU0112|TxExDU0121; recordNumber: TxExDU0112; recordedBy: M. Schilthuizen & I. Njunjić; individualID: TxExDU0112; individualCount: 1; sex: H; associatedMedia: http://www.boldsystems.org/pics/TXEX/TxEx-DU0112- Lim-dorsal +1577602220.jpg|http://www.boldsystems.org/pics/TXEX/slug_5_lateral+1577605397.jpg|http://www.boldsystems.org/pics/TXEX/slug_5_dorsal+1577605353.jpg|http://www.boldsystems.org/pics/TXEX/slug_5+1577602761.jpg|http://www.boldsystems.org/pics/TXEX/TxEx-DU0112- Lim-ventral +1577602257.jpg|http://www.boldsystems.org/pics/TXEX/slug_5_ventral+1577605440.jpg; Taxon : scientificName: Limax pseudocinereoniger; phylum: Mollusca ; class: Gastropoda ; order: Stylommatophora ; family: Limacidae ; genus: Limax ; specificEpithet: pseudocinereoniger; Location : country: Montenegro; locality: Arapova Pecina ; decimalLatitude: 43.0481; decimalLongitude: 19.0793; Identification : identifiedBy: Menno Schilthuizen ; Record Level: institutionCode: Taxon Expeditions B.V.; basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence : occurrenceDetails: http://www.boldsystems.org/index.php/API_ Public /specimen?ids=TxExDU0122|TxExPR0004|TxExDU0041|TxExDU0112|TxExDU0121; recordNumber: TxExDu0121; recordedBy: Rick de Vries ; individualID: TxExDU0121; individualCount: 1; sex: H; associatedMedia: http://www.boldsystems.org/pics/TXEX/slug_7+1577602879.jpg|http://www.boldsystems.org/pics/TXEX/slug_7_lateral+1577605850.jpg|http://www.boldsystems.org/pics/TXEX/DU0121ventral+1577614992.jpg|http://www.boldsystems.org/pics/TXEX/slug_7_dorsal+1577605804.jpg|http://www.boldsystems.org/pics/TXEX/DU0121dorsal+1577614812.jpg|http://www.boldsystems.org/pics/TXEX/DU0121lateral+1577614952.jpg|http://www.boldsystems.org/pics/TXEX/slug_7_ventral+1577605892.jpg; Taxon : scientificName: Limax pseudocinereoniger; phylum: Mollusca ; class: Gastropoda ; order: Stylommatophora ; family: Limacidae ; genus: Limax; specificEpithet: pseudocinereoniger; Location: country: Montenegro; decimalLatitude: 43.2189; decimalLongitude: 19.1759; Identification: identifiedBy: Menno Schilthuizen; Record Level: institutionCode: Taxon Expeditions B.V.; basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence: occurrenceDetails: http://www.boldsystems.org/index.php/API_ Public /specimen?ids=TxExDU0122|TxExPR0004|TxExDU0041|TxExDU0112|TxExDU0121; recordNumber: TxExPr0004; recordedBy: M. Schilthuizen & I. Njunjić; individualID: TxExPR0004; individualCount: 1; sex: H; associatedMedia: http://www.boldsystems.org/pics/TXEX/TxExPR0004vent+1577624611.JPG|http://www.boldsystems.org/pics/TXEX/TxExPR0004dors+1577624546.JPG|http://www.boldsystems.org/pics/TXEX/TxExPR0004late+1577624578.JPG; Taxon : scientificName: Limax pseudocinereoniger; phylum: Mollusca ; class: Gastropoda ; order: Stylommatophora ; family: Limacidae ; genus: Limax ; specificEpithet: pseudocinereoniger; Location : country: Montenegro; locality: Katun Zastan ; decimalLatitude: 42.5203; decimalLongitude: 19.7855; Identification : identifiedBy: Menno Schilthuizen ; Record Level: institutionCode: Taxon Expeditions B.V.; basisOfRecord: PreservedSpecimen GoogleMaps GoogleMaps GoogleMaps GoogleMaps GoogleMaps GoogleMaps GoogleMaps GoogleMaps GoogleMaps GoogleMaps

Description

Holotype: Montenegro, Durmitor National Park, Tara Canyon, 43.21888°N, 19.17588°E, 783 m elev., under rocky overhang, 13 July 2018, locality code: TxEx-DU0041, leg. I. Njunjić & Taxon Expedition participants, 1 adult (dissected and DNA-barcoded): RMNH.MOL.338775 in RMNH, Naturalis Biodiversity Center, Leiden, the Netherlands.

Paratypes: Montenegro, Durmitor National Park, Sušićko Valley, 43.16900°N; 18.99900°E, 1210 m elev., behind loose bark of log, 13 July 2019, locality code: TxEx-DU0122, leg. M. Schilthuizen & Taxon Expedition participants, 1 adult (dissected and DNA-barcoded) in TXEX, Leiden, The Netherlands. Montenegro, Grabovica, 43.04809°N; 19.07934°E, 1564 m elev., under log, 5 July 2019, locality code: TxEx-DU0112, leg. M. Schilthuizen & I. Njunjić, 1 adult (dissected and DNA-barcoded) in TXEX, Leiden, The Netherlands. Montenegro, Durmitor National Park, Tara Canyon, 43.21888°N, 19.17588°E, 783 m elev., in crevice in rock, 12 July 201), locality code: TxEx-DU0121, leg. R de Vries & Taxon Expedition participants, 1 adult (dissected and DNA-barcoded) in TXEX, Leiden, The Netherlands. Montenegro, Prokletije, Katun Zastan, 42.52031°N, 19.78551°E, 1296 m elev., 24 July 2019, leg. M. Schilthuizen & I. Njunjić, 1 adult (DNA-barcoded) in SNSB-ZSM.

Other material. Montenegro, Biogradska Gora (BNM 060820); Bulgaria, Vitosha-Rila-Rhodopes (BNM 062850, BNM 060529, BNM 060561, BNM 063021). (Codes refer to the collection of the Bündner Naturmuseum Chur; material was used for sequencing by B. Nitz, but not studied morphologically by us.)

External appearance.

Large, up to 116 mm long; mantle length up to 37 mm; keel length up to 44 mm (measurements based on alcohol-preserved specimens; living animals can be considerably larger when fully extended). Keel prominent. Colouration monochrome or patterned. Body colour dark brown to black, fading to light brown on the flanks or uniformly light brown (preserved specimens light grey, fading to creamy white on the flanks or uniformly grey to black). Dorsum often darker than the flanks. Keel often (but not always) distinctly brighter than the rest of the dorsal body colour. Mantle colour similar to or darker than the dorsum, always without any patterning (preserved specimens have the mantle similar or lighter than the rest of the dorsum). Inner field of the tripartite sole of the foot always creamy white, outer fields mottled grey or black, fading from posterior to anterior and from the outer edge towards the inner field (similar colouration in preserved specimens). Head colour similar to or lighter than the body, darker dorsally than laterally, sometimes with spotted pattern around the mouth area and on the tentacles. Eye tentacles dark grey to black or creamy white with dark pigmented spots (similar colouration in preserved specimens).

Genitalia. (Based on dissections of five individuals from Montenegro.) See Figs 2 View Figure 2 , 3 View Figure 3 . Hermaphrodite duct long, distally thicker and coiled, cream in colour. Albumen gland yellowish, finger-shaped. Spermoviduct folded. Oviduct white. Free oviduct with capsular gland well developed. Vagina absent. Duct of bursa copulatrix inserts into free oviduct very near to junction with the penis; duct and sac not clearly distinct, sac oval or pear-shaped, fixed with connecting fibres to free oviduct. Atrium very short, almost invisible. Penis tubular, of nearly uniform thickness (but with a bulge of thickened penis wall roughly in the middle), 78 - 90 mm in adult animals or about four-fifths length of body in preserved stage, distal part with ca. four zigzag-bends; proximal part straight, but the final 10-15 mm closest to the vas deferens bent under a sharp angle. Vas deferens inserted close to penis end, leaving 1 - 3 mm blind round tip; penis retractor muscle attached to penis immediately proximal from vas deferens; vas deferens enters penis with a short invaginated papilla. In the penis interior, a short, inconspicuous longitudinal interior penial cord is present only in the distal one-fifth (or less) of the penis. The transversely striated longitudinal interior penial crest runs between (distally) the opening of the duct of the bursa copulatrix and continuing to (proximally) the level of the thickened penis wall. Slightly distal from this point, a more prominent, transversely striated fan-like structure (the internal penial tongue) is developed, which proximally rises to a height similar to the circumference of the penis. In some individuals, the internal penial tongue is contiguous with the longitudinal interior penial crest, but in others, they are separate and run parallel for a short distance. Longitudinal interior penial crest with very fine papillae at the root and towards the proximal part structured with numerous very fine transverse chamfers. Distal half of penis wall internally covered with fine, weak transverse riblets; proximal portion of penis wall smooth without any visible accessory structures besides entrance of vas deferens.

Copulation.

Mating behaviour is important for species distinction in Limax ( Nitz et al. 2009, Nitz 2013). Like L. cinereoniger and, based on Fig. 8.5 and Table 8.2 in Nitz (2013) for a copula from Rila, Bulgaria, mating couples of L. pseudocinereoniger do not suspend themselves from a mucus thread (as is the case in most other Limax species), but instead hang from a mucus spot or mucus 'sail'.

DNA barcode.

The COI barcode of the holotype specimen (BOLD registration code TXEX041-19) is given below. Due to the low quality, we trimmed the 5' and 3' ends by 33 and 50 nucleotides, respectively. However, full DNA barcodes are available in BOLD for the paratypes.

5'TATAGTAGGAACAGGTTTATCTTTATTAATTCGGTTAGAGTTGGGAACAGCGGGCGTTTTAATAGATGATCACTTTT TTAATGTGATTGTAACTGCTCATGCATTTGTTATAATTTTTTTTATAGTAATACCAATTATGATTGGAGGTTTTGGTAATT GAATGGTTCCACTATTAATTGGAGCTCCCGATATAAGATTTCCTCGAATAAACAATATAAGGTTTTGATTATTACCACCT TCTTTTATTTTACTTATTTGTTCTAGTATGGTAGAGGGTGGTGCAGGTACAGGGTGAACTGTATATCCACCTTTAAGGG GACCTTTAGGTCATGGGGGAGCTTCTGTAGATTTAGCTATTTTTTCATTGCATTTAGCTGGGATGTCTTCTATTTTAGG GGCTATTAATTTTATTACAACTATTTTTAACATACGAACGTCAGGGATAACTATAGAACGTGTGAGGTTATTTGTTTGG TCTATTTTAGTAACTGTTTTTCTACTTTTGTTATCTCTTCCTGTATTAGCAGGGGCAATTACTATACTTTTAACAGATCG TAATTTTAATACTAGGT3'

Diagnosis

In external appearance (size and colouration, Fig. 1 View Figure 1 ), L. pseudocinereoniger is very similar to L. cinereoniger , also in its variability in colour and colour pattern. Based on our own observations, as well as those in Nitz (2013) and Bodon et al. (2019), the dorsum is more often brownish than in L. cinereoniger , but otherwise no consistent external distinguishing marks could be discovered. Besides the nearly 10% differentiation in COI-sequence, a few subtle marks of distinction between the two taxa were found in the genitalia. We have listed these below, with indications on whether the distinguishing characters may be generally or only locally applicable.

(i) the one-sided bulge of thickened penis wall of L. pseudocinereoniger is absent in the sympatric L. cinereoniger and we also do not see any evidence of it in the images of the genitalia of L. cinereoniger in Bodon et al. (2019).

(ii) the short longitudinal interior penial cord is distinct, whereas in the sympatric Montenegrin L. cinereoniger specimens that we studied, it is absent or very inconspicuous. However, Bodon et al. (2019) depict animals of L. cinereoniger from other localities in which the longitudinal interior penial cord is as well-developed as in L. pseudocinereoniger . It may, therefore, well be a distinction that only applies to the Montenegrin region of sympatry.

(iii) the longitudinal interior penial crest in L. pseudocinereoniger is highest in its proximal half, whereas in the sympatric Montenegrin L. cinereoniger , it is highest in its distal half. We cannot observe this character in the dissections published by Bodon et al. (2019) for various parts of the L. cinereoniger range, so it may well be a distinction that only applies to the Montenegrin region of sympatry.

Etymology

The specific epithet Limax pseudocinereoniger refers to its similarity with L. cinereoniger . This name was first applied as a "working name" by Nitz (2013) and is here adopted as the formal name. It is used as a masculine adjective.

The taxonomic authority for this species is attributed to all authors of this publication. In line with ICZN Recommendation 51C ( Zoological Nomenclature 1999), the species may be referred to as Limax pseudocinereoniger Schilthuizen et al., 2022, provided the full citation of this publication appears in the bibliography or elsewhere in the referring work.

Kingdom

Animalia

Phylum

Mollusca

Class

Gastropoda

Order

Stylommatophora

Family

Limacidae

Genus

Limax