Phronia reducta Salmela

Salmela, Jukka & Kolcsar, Levente-Peter, 2017, New and poorly known Palaearctic fungus gnats (Diptera, Sciaroidea), Biodiversity Data Journal 5, pp. 11760-11760 : 11760

Phronia reducta Salmela sp. n.

Materials

Type status: Holotype. Occurrence: catalogNumber: DIPT-JS-2015-0272 ; recordedBy: J. Salmela; individualCount: 1; sex: male; Location: country: Finland; stateProvince: Regio kuusamoensis; verbatimLocality: Salla, Iso Pyhätunturi; verbatimLatitude: 66.776; verbatimLongitude: 28.810; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: J. Salmela; Event: samplingProtocol: Malaise trap; eventDate: 2013-7-19 /8-8; habitat: poor - intermediate rich sloping fen; Record Level: institutionCode: ZMUT Type status: Paratype. Occurrence: catalogNumber: 1386 (3) ; recordedBy: G.P. Ostroverkhova; individualCount: 1; sex: male; preparations: slide mounted; Location: country: Russia; stateProvince: Krasnoyarsk region; verbatimLocality: Tungussko-Chunsky District, village Vanavary; verbatimLatitude: 60.33; verbatimLongitude: 102.30; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: J. Salmela; Event: samplingProtocol: sweep net; eventDate: 1972-7-26; habitat: swampy forest; Record Level: institutionCode: TSU

Description

Male. Head dark-brown, vertex covered by pale setae, frons glabrous. Ocelli in a line, central ocellus slightly smaller than laterals; lateral ocelli close to eyes, their distance from eye less than their own width. Eyes pubescent. Palpi brown, bearing light setae. Length ratio of palpal segments 3-5: 3:4=0.83, 4:5=0.69. Penultimate segment 3.6 times as long as wide, last segment 5.3 times as long as wide. Third palpomere with a sensory pit in its base. Antennae brown, 16-segmented (scape, pedicel and 14 flagellomeres), base of pedicel and base of first flagellomere yellowish brown. Scape:pedicel length ratio 1.60. Flagellomeres cylindrical, length:width ratio of 1st flagellomere 2.86, 4th flagellomere 1.75 and apical flagellomere 3.0. Flagellomeres covered by dense light setosity, setae slightly curved, their length shorter than width of respective flagellomere.

Thorax generally dark-brown, except scutum that has yellowish anterior corners. Scutum with mainly pale setosity. Mediotergite bare, other sclerites bearing setae. Scutellum with four stout setae. Halteres pale, bearing weak light setae and setulae.

Wings hyaline, veins brown. Bases of M1 and M2, M1+2, base of r-m, bM1+2, base of Rs and Sc bare, other veins setose. C exceeds tip of R5 very slightly. Sc ending free. Length ratio of M1+2:r-m = 1.18. Wing length 3.1 mm.

Coxae yellow, bearing pale setae, legs yellowish, except femora ventrobasally and apices of hind femora infuscated. Length ratio of femur to tibia for fore, mid and hind legs: 0.95, 0.99, 0.82. Length ratio of tibia to basitarsus for fore, mid and hind legs: 1.03, 1.34, 1.60. Anteroapical depressed area of the fore tibia ovate, having ca. 19 light setae arranged in a slightly curved row. Ratio of apical width of tibia:length of longest tibial spur for fore, mid and hind legs: 0.39, 0.27, 0.24.

Abdominal tergites and sternites brown, bearing light setae. 9th tergite and cerci normal for the genus (Fig. 11a). Ventroapical margin of gonocoxites with a median notch (Fig. 11c). Gonostylus is intricate. Dorsal lobe of gonostylus lingulate, with numerous long setae on ventral margin (Fig. 11d, e). Mesial portion with a plate-like, inward projecting rows of combs (1) (Fig. 11d, e). Internal outgrowth of the ventral lobe of gonostylus is curved and apically notched (2) (Fig. 11e). The basal projection of the ventral lobe of gonostylus is relatively narrow and club-like (3) (Fig. 11d); median projection is the largest, bearing long basal setae and short subapical setae (4) (Fig. 11d, e). Aedeagus short and wide, parameres long, having no long apical setae, only small setulae are present (Fig. 11b, f).

Diagnosis

The new species is close of P. braueri Dziedzicki but differs in the following features; the apices of the parameres are non-setose (the setae here are long in P. braueri ), the internal outgrowth of the ventral lobe of the gonostylus is curved and apically notched (not curved or notched in P. braueri ), and the ventral lobe of the gonostylus also has a narrow club-like basal projection (wedge-shaped and widest basally in P. braueri ).

Etymology

The name of the new species (Latin reducta , reduced, an adjective) is referring to the non-setose apices of the male parameres.

Distribution

Apparently a boreal species, hitherto known from NE Finnish Lapland and Siberia, Central Russia (Fig. 3).

Ecology

The species occurs in sloping fens and swampy forests. The Finnish collecting site (sloping fen) was close to a pine and spruce dominated pristine boreal forest.

Taxon discussion

The new species was illustrated for the first time by Ostroverkhova 1979 (the original illustration is reproduced here, Fig. 12), as P. annulata , (= P. braueri ). These two taxa are indeed closely related, but due to differences in the male hypopygia and DNA barcodes are considered as distinct species (see Diagnosis for details; comparative photos of P. braueri are provided in Fig. 13). There are a total of 10 slide-mounted " Phronia braueri " in TSU that were studied by Ostroverkhova, all of them collected from two close-lying localities, between dates 19.-29.7.1972. Unfortunately these slides are in poor condition making it difficult to identify them to species level; however the slide in the best condition was selected as the paratype.

There are two questionable older names of P. braueri , namely P. annulata Winnertz and P. vittata Winnertz ( Winnertz 1863, Hackman et al. 1988), both are considered here as nomina dubia. These species are known from holotype females only and females of P. braueri are difficult to separate from P. forcipata Winnertz ( Hackman 1970). It is also likely that the type specimens were destroyed during WWII ( Kurina 2004, citing Evenhuis 1997). Furthermore, most likely the type specimens of both P. annulata and P. vittata were collected from Krefeld, Germany, that is a nemoral lowland area. We consider P. reducta sp.n. having a boreal range, being absent from Central Europe. Thus, we find it very unlikely that these nomina dubia would be conspecific with the new species.

DNA barcoding

Holotype male: BOLD Sample ID: DIPT-JS-2015-0272. BOLD Process ID: SCFI741-16. GenBank accession number: KY062992.

AATTTTATATTTTATTTTTGGAGCTTGATCTGGAATAGTGGGAACTTCTCTTAGAATTATTATTCGGACTGAATTAGGACATCCAGGAGCATTAATTGGTAATGACCAAATTTATAATGTTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCACTAATACTAGGAGCCCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGGTTATTACCTCCTTCTCTTACATTATTACTTTCTAGAAGTTTAGTAGAAGCAGGGGCTGGAACTGGTTGAACAGTTTACCCTCCCCTTTCTTCAACTATTGCTCATGCTGGCGCATCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATTTCATCAATTTTAGGGGCAGTTAATTTTATTACTACCATTATTAATATACGAGCTCCTGGAATCACTTTTGATCGTTTACCTTTATTTGTTTGATCTGTTCTTATTACAGCAGTATTACTATTATTATCTTTACCCGTATTAGCAGGAGCTATTACTATACTATTAACAGACCGAAATCTTAATACTTCATTTTTTGACCCTGCAGGGGGAGGAGATCCTATTTTATACCAACATTTATTT

The holotype male is the only member of the BIN BOLD:ADD3565. This specimen has no very close matches in BOLD database. The closest matches are 44 Phronia specimens, whose similarities to the new species range between 96,74 - 96,01. One of these specimens is assigned to P. braueri , the sister species of P. reducta sp.n. That P. braueri specimen is collected from Norway and was identified by J. Kjaerandsen (unpublished record).