Anacharis eucharioides (Dalman, 1818)

Vogel, Jonathan, Forshage, Mattias, Bartsch, Saskia B., Ankermann, Anne, Mayer, Christoph, von Falkenhausen, Pia, Rduch, Vera, Müller, Björn, Braun, Christoph, Krammer, Hans-Joachim & Peters, Ralph S., 2024, Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species, Journal of Hymenoptera Research 97, pp. 621-698 : 621-698

publication ID

https://doi.org/ 10.3897/jhr.97.131350

publication LSID

lsid:zoobank.org:pub:EA190992-B01B-4F1B-A362-A4549C725580

DOI

https://doi.org/10.5281/zenodo.13538481

persistent identifier

https://treatment.plazi.org/id/4E0D406E-FFFA-560A-BA7C-D2ADA7DBC1B2

treatment provided by

Journal of Hymenoptera Research by Pensoft

scientific name

Anacharis eucharioides (Dalman, 1818)
status

 

Anacharis eucharioides (Dalman, 1818)

Figs 2 G View Figure 2 , 3 F View Figure 3 , 10 A – E View Figure 10

Cynips eucharioides Dalman, 1818: 78 - type lost.

Anacharis tinctus Walker, 1835: 520 - lectotype ( NHMUK) ♀, synonymised in Fergusson (1968), photographs examined.

Megapelmus spheciformis Hartig, 1840: 202 (removed from synonymy with A. typica ) - lectotype ( ZSM) ♂, first synonymised in Reinhard (1860), examined.

Anacharis fergussoni Mata-Casanova & Pujade-Villar, 2018: 16 syn. nov. - holotype ( CNC) ♀, photographs examined. View Cited Treatment

Anacharis eucharoides auct., common misspelling.

Diagnosis

(n = 290). Most common species within the eucharioides species group. Medium sized body (2.7–3.4, mean 3.1 mm, similar to A. typica , A. petiolata & A. martinae ). Differing from A. typica and A. petiolata by having a mesoscutellum with a median carina present, which is typically interrupted centrally by reticulation (largely smooth and even in A. petiolata and A. typica ) (Fig. 10 D View Figure 10 ). Differing from A. martinae by having the lateromedial area of the pronotum smooth to rugose (Fig. 10 B View Figure 10 , with longitudinal carinae that are a continuation of the ventral carinae in A. martinae ). Unique in usually having the mesoscutum glabrous to more sparsely pubescent than the rest of the mesoscutum (Fig. 10 D View Figure 10 , more evenly pubescent in all other species). The male genitalia of A. eucharioides (Fig. 3 F View Figure 3 ) are unique in not being significantly widened basally or medially, i. e. being more parallel-sided (basally or medially widened in all other species Fig. 3 C – E View Figure 3 ).

CO 1 barcode.

n = 289. Maximum intraspecific distance = 2.5 %. Minimum distance to closest species ( A. petiolata ) = 2.9 %. CO 1 barcode consensus sequence:

AATTTTATACTTTATTTTAGGTATTTGATCTGGAATAATAGGATCAAGATTAAGAATAATTATTCGAAT AGAATTAGGAACCCCATCTCAATTAATCATAAATGATCAAATTTATAATTCAATTGTAACTGCTCATGCA TTTATTATAATTTTCTTTATAGTTATACCTATTATAGTTGGAGGATTTGGGAATTATTTAGTACCTTTAA TATTAATTTCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGATTTTTAATCCCTTCCTT ATTTTTAATAACAATTAATTTATTTATTGATCAAGGAGCAGGAACAGGATGAACTGTTTACCCTCCATTA TCCTCCCTAACAGGTCATCCATCTATATCAGTAGATTTAGTTATTTACTCATTACATTTAAGTGGAATTT CATCAATTCTTGGATCAATTAATTTTATTGTAACCATTTTAAATATACGAATAACTTCTATATCTATAGA CAAAATTTCATTATTTATTTGATCTATTTTTCTAACTACAATTTTACTATTATTATCTTTACCCGTACTA GCAGGAGGATTAACGATACTATTATTTGATCGAAATTTAAATACATCTTTTTTTGACCCCACAGGAGGAG GAGACCCTATTCTTTATCAACATTTATTT

Type material.

Lectotype of Anacharis tinctus Walker, 1835 , designated by Fergusson (1986)

81 86 [on backside of mounting board]

Type

B. M. 1981. Under tincta

LECTO-TYPE

LECTOTYPE Anacharis tincta Walker det. N. D. M. Fergusson, 1981

B. M. TYPE HYM 7.162

[QR code] NHMUK 012858912

[for images, see https://data.nhm.ac.uk/dataset/56e711e6-c847-4f99-915a-6894bb5c5dea/resource/05ff2255-c38a-40c9-b657-4ccb55ab2feb/record/10470209]

Lectotype of Megapelmus spheciformis Hartig, 1840 , designated by Weld (1952)

Weld 1931

Megapelmus spheciformis [handwritten, probably by Hartig himself]

LECTOTYPE of MEGAPELMUS spheciformis det. N. D. M. Fergusson, 1982

Anacharis eucharoides Dal. det. N. D. M. Fergusson, 1982

Anacharis eucharioides (Dalman, 1818) ♂ Det. Jonathan Vogel 2024

Holotype of Anacharis fergussoni Mata-Casanova & Pujade-Villar, 2018

Germany • 1 ♀; Rhineland Palatinate, Mainz-Bingen, Ingelheim am Rhein , orchard; 1–30 Sep. 1968; I. Sreffan leg.; Malaise trap .

[for images, see https://www.cnc.agr.gc.ca/taxonomy/Specimen.php?id=3274133]

Other material examined.

DNA barcode voucher s. Belgium • 1 ♀; East Flanders, Assenede, Isabellepolder , Agricultural land with Partridge mix; 51.266 ° N, 3.71 ° E; ca 0 m a. s. l.; 12–19 Jun. 2019; UGent leg.; yellow pan trap; ZFMK -TIS-2640673 GoogleMaps . • 2 ♂♂; West Flanders, Ypres, De Triangel , Urban park (bushes); 50.8418 ° N, 2.8838 ° E; ca 20 m a. s. l.; 30 Apr. - 14 May 2022; Verheyde, Fons leg.; Malaise trap; ZFMK -TIS-2640843 , ZFMK -TIS-2640844 GoogleMaps . • 3 ♀♀, 9 ♂♂; same collection data as for preceding 14–28 May 2022; females - ZFMK -TIS-2640845 , ZFMK -TIS-2640846 , ZFMK -TIS-2640847 , ZFMK -TIS-2640859 , ZFMK -TIS-2640860 , ZFMK -TIS-2640861 ; males - ZFMK -TIS-2640848 , ZFMK -TIS-2640849 , ZFMK -TIS-2640850 , ZFMK -TIS-2640851 , ZFMK -TIS-2640852 , ZFMK -TIS-2640853 , ZFMK -TIS-2640854 , ZFMK -TIS-2640855 , ZFMK -TIS-2640856 , ZFMK -TIS-2640862 , ZFMK -TIS-2640863 GoogleMaps . • 1 ♂; same collection data as for preceding 2–23 Jul. 2022; ZFMK -TIS-2640868 GoogleMaps . • 3 ♀♀, 2 ♂♂; West Flanders, Ypres, De Triangel , Urban park (pool vegetation); 50.8427 ° N, 2.884 ° E; ca 20 m a. s. l.; 14–28 May 2022; Verheyde, Fons leg.; Malaise trap; females - ZFMK -TIS-2640859 , ZFMK -TIS-2640860 , ZFMK -TIS-2640861 ; males - ZFMK -TIS-2640862 , ZFMK -TIS-2640863 GoogleMaps .

Germany • 1 ♂; Baden-Württemberg, Biberach, Altheim ; 48.1399 ° N, 9.4491 ° E; ca 540 m a. s. l.; 6–19 Aug. 2013; Schmalfuß, H. leg.; Malaise trap; ZFMK -TIS-2629512 GoogleMaps . • 2 ♀♀, 8 ♂♂; Baden-Württemberg, Karlsruhe, Malsch, Hansjakobstraße , garden; 48.8835 ° N, 8.3197 ° E; ca 120 m a. s. l.; 26 Apr. - 10 May 2020; Dieter Doczkal leg.; Malaise trap; females - ZFMK -TIS-2640753 , ZFMK -TIS-2640754 ; males - ZFMK -TIS-2640745 , ZFMK -TIS-2640746 , ZFMK -TIS-2640747 , ZFMK -TIS-2640748 , ZFMK -TIS-2640749 , ZFMK -TIS-2640750 , ZFMK -TIS-2640751 , ZFMK -TIS-2640752 GoogleMaps . • 1 ♂; same collection data as for preceding 25 Oct. - 8 Nov. 2020; ZFMK -TIS-2640726 GoogleMaps . • 11 ♀♀, 1 ♂; Baden-Württemberg, Stuttgart, Espan ; 49.6167 ° N, 9.2667 ° E; ca 280 m a. s. l.; 28 Jul. - 28 Aug. 2014; Woog, F. leg.; females - ZFMK -TIS-2640775 , ZFMK -TIS-2640776 , ZFMK -TIS-2640777 , ZFMK -TIS-2640778 , ZFMK -TIS-2640779 , ZFMK -TIS-2640780 , ZFMK -TIS-2640781 , ZFMK -TIS-2640782 , ZFMK -TIS-2640783 , ZFMK -TIS-2640784 , ZFMK -TIS-2640785 ; male - ZFMK -TIS-2640786 GoogleMaps . • 1 ♀, 10 ♂♂; Baden-Württemberg, Tübingen, Hirschau, Oberes Tal , orchard; 48.505 ° N, 8.993 ° E; ca 390 m a. s. l.; 29 Apr. - 13 May 2014; Kothe, T., Engelhardt, M., Bartsch, D. leg.; Malaise trap; female - ZFMK -TIS-2629263 ; males - ZFMK -TIS-2629200 , ZFMK -TIS-2629201 , ZFMK -TIS-2629202 , ZFMK -TIS-2629203 , ZFMK -TIS-2629204 , ZFMK -TIS-2629218 , ZFMK -TIS-2629540 , ZFMK -TIS-2629541 , ZFMK -TIS-2629542 , ZFMK -TIS-2640774 GoogleMaps . • 1 ♂; Baden-Württemberg, Tübingen, Hirschau, Oberes Tal , orchard; 48.505 ° N, 8.9935 ° E; ca 370 m a. s. l.; 23 May- 6 Jun. 2014; Kothe, T., Engelhardt, M., Bartsch, D. leg.; Malaise trap; ZFMK -TIS-2628235 GoogleMaps . • 3 ♀♀; Baden-Württemberg, Tübingen, Hirschau, Wiesenweingärten ; 48.5043 ° N, 8.9956 ° E; ca 380 m a. s. l.; 17–31 Jul. 2014; Kothe, T., Engeldhardt, M., König, C. leg.; Malaise trap; ZFMK -TIS-2629238 , ZFMK -TIS-2629267 , ZFMK -TIS-2629268 GoogleMaps . • 1 ♀; Baden-Württemberg, Tübingen, Steinenberg ; 48.5306 ° N, 9.0312 ° E; ca 470 m a. s. l.; 31 Jul. - 14 Aug. 2014; Kothe, T., Engeldhardt, M., König, C. leg.; Malaise trap; ZFMK -TIS-2629237 GoogleMaps . • 4 ♀♀; Baden-Württemberg, Tübingen, Steinenberg ; 48.5313 ° N, 9.03 ° E; ca 490 m a. s. l.; 4–17 Jul. 2014; Kothe, T., Engelhardt, M., König, Ch. leg.; ZFMK -TIS-2629504 , ZFMK -TIS-2629505 , ZFMK -TIS-2629506 , ZFMK -TIS-2629507 GoogleMaps . • 1 ♀, 1 ♂; Baden-Württemberg, Tübingen, Steinenbergturm ; 48.531 ° N, 9.03 ° E; ca 490 m a. s. l.; 14–29 Aug. 2014; Kothe, T., Engeldhardt, M., König, C. leg.; Malaise trap; female - ZFMK -TIS-2629236 ; male - ZFMK -TIS-2629219 GoogleMaps . • 1 ♂; Baden-Württemberg, Tübingen, Wurmlingen, Gengental , orchard; 48.5131 ° N, 8.9923 ° E; ca 370 m a. s. l.; 13–23 May 2014; Kothe, T., Engeldhardt, M., König, C. leg.; Malaise trap; ZFMK -TIS-2640681 GoogleMaps . • 1 ♀, 1 ♂; Bavaria, Main-Spessart, Lohr, Nat. res. Romberg , pasture woodland; 49.9864 ° N, 9.5896 ° E; ca 190 m a. s. l.; 9 Jun. - 6 Jul. 2018; Dieter Doczkal leg.; Malaise trap; female - ZFMK -TIS-2640717 ; male - ZFMK -TIS-2640716 GoogleMaps . • 1 ♂; Bavaria, Rhön-Grabfeld, Fladungen, Nat. res. Schwarzes Moor , Karpatenbirkenwald; 50.5117 ° N, 10.071 ° E; ca 780 m a. s. l.; 26 Jun. - 18 Jul. 2017; Dieter Doczkal leg.; Malaise trap; ZFMK -TIS-2629538 GoogleMaps . • 2 ♀♀; Hesse, Gießen, Nat. res. Holzwäldchen bei Gleiberg ; 50.605 ° N, 8.6316 ° E; ca 190 m a. s. l.; 14 Jun. 2021; GBOL III leg.; sweep net; ZFMK -TIS-2629494 , ZFMK -TIS-2629495 GoogleMaps . • 1 ♀; Hesse, Kassel, Nat. res., „ Fuldaschleuse Wolfsanger “ , meadow along Fulda river with Salix and Phragmites; 51.329 ° N, 9.5565 ° E; ca 130 m a. s. l.; 13–27 Oct. 2020; GBOL III leg.; sweep net; Loc. 1; ZFMK -TIS-2628230 GoogleMaps . • 3 ♀♀; Hesse, Rheingau-Taunus, Lorch am Rhein, above Nollig castle ; 50.0491 ° N, 7.7978 ° E; ca 240 m a. s. l.; 27 May- 7 Jun. 2013; Niehuis, Oliver leg.; Malaise trap; MF 1; ZFMK -TIS-2629498 , ZFMK -TIS-2629499 , ZFMK -TIS-2629500 GoogleMaps . • 1 ♀, 1 ♂; same collection data as for preceding 17–25 Jun. 2015; MF 4; female - ZFMK -TIS-2629248 ; male - ZFMK -TIS-2629214 GoogleMaps . • 8 ♂♂; same collection data as for preceding 15–21 Jul. 2013; MF 1; ZFMK -TIS-2629227 , ZFMK -TIS-2629240 , ZFMK -TIS-2629241 , ZFMK -TIS-2629521 , ZFMK -TIS-2629522 , ZFMK -TIS-2629523 , ZFMK -TIS-2629524 , ZFMK -TIS-2629525 GoogleMaps . • 20 ♂♂; same collection data as for preceding 21–27 Jul. 2013; ZFMK -TIS-2629225 , ZFMK -TIS-2629226 , ZFMK -TIS-2629553 , ZFMK -TIS-2629554 , ZFMK -TIS-2629555 , ZFMK -TIS-2629556 , ZFMK -TIS-2629557 , ZFMK -TIS-2629558 , ZFMK -TIS-2629559 , ZFMK -TIS-2629560 , ZFMK -TIS-2629576 , ZFMK -TIS-2629577 , ZFMK -TIS-2640820 , ZFMK -TIS-2640821 , ZFMK -TIS-2640822 , ZFMK -TIS-2640823 , ZFMK -TIS-2640824 , ZFMK -TIS-2640825 , ZFMK -TIS-2640826 , ZFMK -TIS-2640827 GoogleMaps . • 1 ♀; Hesse, Rheingau-Taunus, Lorch am Rhein, above Nollig castle ; 50.0495 ° N, 7.7966 ° E; ca 250 m a. s. l.; 12–17 Jun. 2015; Niehuis, Oliver leg.; Malaise trap; MF 3; ZFMK -TIS-2629252 GoogleMaps . • 3 ♂♂; same collection data as for preceding 17–25 Jun. 2015; ZFMK -TIS-2628232 , ZFMK -TIS-2629212 , ZFMK -TIS-2629213 GoogleMaps . • 1 ♀; Hesse, Rheingau-Taunus, Lorch am Rhein, above Nollig castle ; 50.0498 ° N, 7.7974 ° E; ca 260 m a. s. l.; 27 May- 7 Jun. 2013; Niehuis, Oliver leg.; Malaise trap; MF 2; ZFMK -TIS-2629266 GoogleMaps . • 2 ♀♀; same collection data as for preceding 7–15 Jun. 2013; ZFMK -TIS-2628233 , ZFMK -TIS-2629250 GoogleMaps . • 5 ♀♀; same collection data as for preceding 15–23 Jun. 2013; ZFMK -TIS-2629269 , ZFMK -TIS-2629270 , ZFMK -TIS-2629271 , ZFMK -TIS-2629501 , ZFMK -TIS-2629502 GoogleMaps . • 7 ♂♂; same collection data as for preceding 15–21 Jul. 2013; ZFMK -TIS-2629513 , ZFMK -TIS-2629515 , ZFMK -TIS-2629550 , ZFMK -TIS-2629551 , ZFMK -TIS-2629552 , ZFMK -TIS-2640710 , ZFMK -TIS-2640711 GoogleMaps . • 12 ♂♂; same collection data as for preceding 21–27 Jul. 2013; ZFMK -TIS-2629243 , ZFMK -TIS-2629244 , ZFMK -TIS-2629245 , ZFMK -TIS-2629246 , ZFMK -TIS-2629496 , ZFMK -TIS-2629497 , ZFMK -TIS-2629527 , ZFMK -TIS-2629528 , ZFMK -TIS-2629529 , ZFMK -TIS-2629530 , ZFMK -TIS-2629531 , ZFMK -TIS-2629532 GoogleMaps . • 1 ♀, 1 ♂; Hesse, Waldeck-Frankenberg, National park Kellerwald-Edersee, Banfehaus , old floodplain of the Banfe; 51.167 ° N, 8.9749 ° E; ca 270 m a. s. l.; 22 Jul. - 5 Aug. 2021; GBOL III leg.; Malaise trap (Krefeld version); female - ZFMK -TIS-2640790 ; male - ZFMK -TIS-2640792 GoogleMaps . • 2 ♀♀; Hesse, Waldeck-Frankenberg, National park Kellerwald-Edersee, Maierwiesen ; 51.1555 ° N, 9.0015 ° E; ca 370 m a. s. l.; 22 Jun. - 8 Jul. 2021; GBOL III leg.; Malaise trap (Krefeld version); ZFMK -TIS-2640807 , ZFMK -TIS-2640808 GoogleMaps . • 9 ♀♀, 1 ♂; Hesse, Waldeck-Frankenberg, NP Kellerwald-Edersee, „ Banfe-Haus “ ; 51.167 ° N, 8.9749 ° E; ca 270 m a. s. l.; 7–21 Jul. 2022; GBOL III leg.; Malaise trap; females - ZFMK -TIS-2640761 , ZFMK -TIS-2640762 , ZFMK -TIS-2640763 , ZFMK -TIS-2640764 , ZFMK -TIS-2640765 , ZFMK -TIS-2640766 , ZFMK -TIS-2640767 , ZFMK -TIS-2640768 , ZFMK -TIS-2640769 ; male - ZFMK -TIS-2640755 GoogleMaps . • 1 ♀; Hesse, Waldeck-Frankenberg, NP Kellerwald-Edersee, „ Kleiner Mehlberg “; 51.2105 ° N, 9.042 ° E; ca 360 m a. s. l.; 30 Sep. - 14 Oct. 2021; GBOL III leg.; Malaise trap; ZFMK -TIS-2640610 GoogleMaps . • 1 ♂; Hesse, Waldeck-Frankenberg, NP Kellerwald-Edersee, „ Maierwiesen “; 51.1555 ° N, 9.0015 ° E; ca 370 m a. s. l.; 8–22 Jul. 2021; GBOL III leg.; Malaise trap; ZFMK -TIS-2640732 GoogleMaps . • 1 ♀; Lower Saxony, Lüchow-Dannenberg, Pevestorf, Deichvorland & Deich ; 53.0636 ° N, 11.4742 ° E; ca 20 m a. s. l.; 6–10 Aug. 2013; Krogmann, Lars leg.; Malaise trap; ZFMK -TIS-2629251 GoogleMaps . • 1 ♀, 3 ♂♂; North Rhine-Westphalia, Bonn, Garden of Museum Koenig , Various habitats; 50.7215 ° N, 7.1137 ° E; ca 70 m a. s. l.; 4 Jul. 2022; Schwingeler, Josefine, Jonathan Vogel leg.; sweep net; female - ZFMK -TIS-2640738 ; males - ZFMK -TIS-2640735 , ZFMK -TIS-2640736 , ZFMK -TIS-2640737 GoogleMaps . • 2 ♀♀; North Rhine-Westphalia, Bonn, Museum Koenig , garden; 50.7214 ° N, 7.1139 ° E; ca 70 m a. s. l.; 4 Oct. 2022; Salden, Tobias leg.; sweep net; ZFMK -TIS-2635303 , ZFMK -TIS-2635304 GoogleMaps . • 1 ♀; North Rhine-Westphalia, Borken, Borken , spinach field with flower strip; 51.8078 ° N, 6.8324 ° E; ca 60 m a. s. l.; 2–9 Aug. 2016; Schwarz et al. leg.; Malaise trap; ZFMK -TIS-2629284 GoogleMaps . • 1 ♂; North Rhine-Westphalia, Delbrück, Delbrück, Nat. res. „ Steinhorster Becken “ ; 51.8217 ° N, 8.542 ° E; ca 90 m a. s. l.; 22 Jul. - 5 Aug. 2021; GBOL III leg.; Malaise trap; ZFMK -TIS-2640677 GoogleMaps . • 1 ♀; North Rhine-Westphalia, Paderborn, Delbrück, Nat. res. „ Erdgarten-Lauerwiesen “ , alder carr surrounded by wet meadows, ponds, muddy, geese; 51.7989 ° N, 8.6582 ° E; ca 110 m a. s. l.; 31 Aug. - 14 Sep. 2021; GBOL III leg.; Malaise trap; ZFMK -TIS-2640674 GoogleMaps . • 1 ♀; North Rhine-Westphalia, Paderborn, Delbrück, Nat. res. „ Steinhorster Becken “ ; 51.82 ° N, 8.5409 ° E; ca 90 m a. s. l.; 19 Aug. - 2 Sep. 2021; GBOL III leg.; Malaise trap; ZFMK -TIS-2640692 GoogleMaps . • 1 ♀, 1 ♂; same collection data as for preceding 2–16 Sep. 2021; female - ZFMK -TIS-2640715 ; male - ZFMK -TIS-2640714 GoogleMaps . • 1 ♀, 4 ♂♂; same collection data as for preceding 16–30 Sep. 2021; female - ZFMK -TIS-2640803 ; males - ZFMK -TIS-2640799 , ZFMK -TIS-2640800 , ZFMK -TIS-2640801 , ZFMK -TIS-2640802 GoogleMaps . • 9 ♂♂; same collection data as for preceding 30 Sep. - 14 Oct. 2021; ZFMK -TIS-2640810 , ZFMK -TIS-2640811 , ZFMK -TIS-2640812 , ZFMK -TIS-2640813 , ZFMK -TIS-2640814 , ZFMK -TIS-2640815 , ZFMK -TIS-2640816 , ZFMK -TIS-2640817 , ZFMK -TIS-2640818 GoogleMaps . • 1 ♀; North Rhine-Westphalia, Paderborn, Delbrück, Nat. res. „ Steinhorster Becken “ ; 51.8252 ° N, 8.5359 ° E; ca 90 m a. s. l.; 19 Aug. - 2 Sep. 2021; GBOL III leg.; Malaise trap; ZFMK -TIS-2640693 GoogleMaps . • 6 ♂♂; same collection data as for preceding 2–16 Sep. 2021; ZFMK -TIS-2640793 , ZFMK -TIS-2640794 , ZFMK -TIS-2640795 , ZFMK -TIS-2640796 , ZFMK -TIS-2640797 , ZFMK -TIS-2640798 GoogleMaps . • 4 ♂♂; same collection data as for preceding 16–30 Sep. 2021; ZFMK -TIS-2640727 , ZFMK -TIS-2640728 , ZFMK -TIS-2640729 , ZFMK -TIS-2640730 GoogleMaps . • 1 ♀; North Rhine-Westphalia, Rhein-Sieg-Kreis, Oberdrees, Buschfeld ; 50.6371 ° N, 6.9157 ° E; ca 160 m a. s. l.; 28 May- 6 Jun. 2021; GBOL III leg.; Malaise trap; ZFMK -TIS-2640679 GoogleMaps . • 1 ♀; North Rhine-Westphalia, Rhein-Sieg-Kreis, Schladern near Windeck, Sieg river , right river bank; 50.8 ° N, 7.585 ° E; ca 130 m a. s. l.; 30 May- 6 Jun. 2017; ZFMK et al. leg.; Malaise trap; ZFMK -TIS-2628234 GoogleMaps . • 1 ♀; same collection data as for preceding 6–13 Jun. 2017; ZFMK -TIS-2629239 GoogleMaps . • 1 ♀; same collection data as for preceding 13–20 Jun. 2017; ZFMK -TIS-2629262 GoogleMaps . • 4 ♀♀; same collection data as for preceding 20–27 Jun. 2017; ZFMK -TIS-2629279 , ZFMK -TIS-2629280 , ZFMK -TIS-2629281 , ZFMK -TIS-2629282 GoogleMaps . • 2 ♀♀; same collection data as for preceding 27 Jun. - 4 Jul. 2017; ZFMK -TIS-2629260 , ZFMK -TIS-2629261 GoogleMaps . • 3 ♀♀; same collection data as for preceding 4–11 Jul. 2017; ZFMK -TIS-2629264 , ZFMK -TIS-2629275 , ZFMK -TIS-2629277 GoogleMaps . • 10 ♀♀, 23 ♂♂; same collection data as for preceding 18–25 Jul. 2017; females - ZFMK -TIS-2629290 , ZFMK -TIS-2629292 , ZFMK -TIS-2629487 , ZFMK -TIS-2629488 , ZFMK -TIS-2629489 , ZFMK -TIS-2629490 , ZFMK -TIS-2629508 , ZFMK -TIS-2629561 , ZFMK -TIS-2629562 , ZFMK -TIS-2629563 ; males - ZFMK -TIS-2629217 , ZFMK -TIS-2629247 , ZFMK -TIS-2629265 , ZFMK -TIS-2629286 , ZFMK -TIS-2629287 , ZFMK -TIS-2629288 , ZFMK -TIS-2629291 , ZFMK -TIS-2629293 , ZFMK -TIS-2629294 , ZFMK -TIS-2629486 , ZFMK -TIS-2629492 , ZFMK -TIS-2629510 , ZFMK -TIS-2629511 , ZFMK -TIS-2629518 , ZFMK -TIS-2629519 , ZFMK -TIS-2629520 , ZFMK -TIS-2629564 , ZFMK -TIS-2629565 , ZFMK -TIS-2629566 , ZFMK -TIS-2629567 , ZFMK -TIS-2629569 , ZFMK -TIS-2629570 , ZFMK -TIS-2629571 GoogleMaps . • 7 ♀♀, 19 ♂♂; same collection data as for preceding 1–8 Aug. 2017; females - ZFMK -TIS-2629253 , ZFMK -TIS-2629254 , ZFMK -TIS-2629255 , ZFMK -TIS-2629256 , ZFMK -TIS-2629257 , ZFMK -TIS-2629258 , ZFMK -TIS-2629259 ; males - ZFMK -TIS-2629215 , ZFMK -TIS-2629224 , ZFMK -TIS-2629228 , ZFMK -TIS-2629231 , ZFMK -TIS-2629232 , ZFMK -TIS-2629233 , ZFMK -TIS-2629234 , ZFMK -TIS-2629235 , ZFMK -TIS-2629543 , ZFMK -TIS-2629544 , ZFMK -TIS-2629545 , ZFMK -TIS-2629546 , ZFMK -TIS-2629547 , ZFMK -TIS-2629548 , ZFMK -TIS-2629549 , ZFMK -TIS-2629572 , ZFMK -TIS-2629573 , ZFMK -TIS-2629574 , ZFMK -TIS-2629575 GoogleMaps . • 2 ♂♂; same collection data as for preceding 15–30 Aug. 2017; ZFMK -TIS-2629220 , ZFMK -TIS-2640675 GoogleMaps . • 1 ♂; Rhineland-Palatinate, Ahrweiler, Niederzissen, Bausenberg ; 50.4679 ° N, 7.2223 ° E; ca 330 m a. s. l.; 12–27 Jul. 2022; Jaume-Schinkel, Santiago leg.; Gressit Malaise trap; ZFMK -TIS-2640672 GoogleMaps . • 1 ♀, 1 ♂; Rhineland-Palatinate, Ahrweiler, Niederzissen, Bausenberg , dry grassland; 50.4647 ° N, 7.2222 ° E; ca 320 m a. s. l.; 14–20 Jul. 2017; ZFMK et al. leg.; Malaise trap; MF 5; female - ZFMK -TIS-2629509 ; male - ZFMK -TIS-2629516 GoogleMaps . • 1 ♀; Rhineland-Palatinate, Alzey-Worms, Wine fields north of Monsheim , shrub islands between wine fields, mostly poplars; 49.6406 ° N, 8.2137 ° E; ca 150 m a. s. l.; 5–24 Aug. 2021; Gilgenbach, Carolin leg.; Malaise trap; ZFMK -TIS-2640678 GoogleMaps . • 1 ♂; Rhineland-Palatinate, Cochem, Nat. res. Brauselay ; 50.1421 ° N, 7.1881 ° E; ca 120 m a. s. l.; 29 May 2020; DINA leg.; Malaise trap; ZFMK -TIS-2629216 ( EVK) GoogleMaps . • 1 ♀; Saarland, Neunkirchen, Schiffweiler, Landsweiler-Reden , Höfertal ; 50.0767 ° N, 7.3283 ° E; ca 370 m a. s. l.; 18 Jun. 2022; AK Diptera leg.; sweep net; ZFMK -TIS-2640838 GoogleMaps . • 1 ♂; Saarland, Saarpfalz, Gersheim ; 49.31 ° N, 8.1683 ° E; ca 140 m a. s. l.; 19 Jun. 2022; AK Diptera leg.; sweep net; ZFMK -TIS-2640839 GoogleMaps . • 2 ♂♂; Schleswig-Holstein, Nordfriesland, Nat. res. Luetjenholmer Heidedünen ; 54.6963 ° N, 9.0643 ° E; ca 0 m a. s. l.; 29 May 2020; DINA leg.; Malaise trap; ZFMK -TIS-2629229 ( EVK), ZFMK -TIS-2629230 ( EVK) GoogleMaps .

Lithuania • 1 ♀; Silute distr., Sysa, Sysa , control plot; 55.3127 ° N, 21.4049 ° E; ca 0 m a. s. l.; 15–25 Jul. 2020; Petrasiunas, Andrius leg.; Malaise trap; ZFMK -TIS-2637713 GoogleMaps .

The Netherlands • 1 ♂; Noord-Holland, Amsterdam, Vondelpark ; 52.3581 ° N, 4.8681 ° E; ca 0 m a. s. l.; 3–12 Jun. 2019; Taxon Expeditions Team leg.; Malaise trap; ZFMK -TIS-2640687 GoogleMaps . • 2 ♀♀, 1 ♂; same collection data as for preceding 12–15 Jun. 2019; females - ZFMK -TIS-2640718 , ZFMK -TIS-2640719 ; male - ZFMK -TIS-2640720 GoogleMaps . • 1 ♂; same collection data as for preceding 21–25 Jun. 2019; ZFMK -TIS-2640689 GoogleMaps . • 1 ♀; same collection data as for preceding 19–27 Jul. 2019 GoogleMaps . • 2 ♀♀, 1 ♂; same collection data as for preceding 7 Aug. 2019; females - ZFMK -TIS-2640721 , ZFMK -TIS-2640722 ; male - ZFMK -TIS-2640723 GoogleMaps . • 2 ♂♂; Noord-Holland, Amsterdam, Vondelpark , Urban park; 52.356 ° N, 4.861 ° E; ca 0 m a. s. l.; 19–27 Jul. 2019; Taxon Expeditions (M. Schilthuizen) leg.; Malaise trap; ZFMK -TIS-2640841 , ZFMK -TIS-2640842 GoogleMaps . • 1 ♀; same collection data as for preceding 2019; ZFMK -TIS-2640840 GoogleMaps .

Norway • 1 ♂; Rogaland Ytre, Finnøy, Nordre Vignes ; 59.1679 ° N, 5.7883 ° E; ca 10 m a. s. l.; 22 Sep. - 1 Nov. 2020; Tengesdal, Gaute leg.; Malaise trap; ZFMK -TIS-2640680 GoogleMaps .

Material without DNA barcode. Belgium • 1 ♂; Walloon Brabant, Ottignies ; 3–10 Sep. 1983; Paul Dessart leg.; Malaise trap; JV_Prel_0057 ( RBINS) . • 1 ♀, 1 ♂; Walloon Region, Luik, Wanze, Antheit ( Corphalie ); 50.5363 ° N, 5.2515 ° E; ca 110 m a. s. l.; 14–28 Jul. 1989; R. Detry leg.; Malaise trap; ZFMK -HYM-00039669 , JV_Prel_0044 ( RBINS) GoogleMaps . • 1 ♂; same collection data as for preceding 28 Jul. - 11 Aug. 1989; JV_Prel_0054 ( RBINS) GoogleMaps . • 1 ♀, 1 ♂; West Flanders, Oostkamp , Private garden; 51.168 ° N, 3.276 ° E; ca 0 m a. s. l.; 16–30 Aug. 2020; Arnout Zwaenepoel leg.; Malaise trap; female - ZFMK -TIS-2640697 ; male - ZFMK -TIS-2640696 GoogleMaps . • 1 ♂; West Flanders, Snellegem, Vloethembos ; 9 Jun. 1983; P. Grootaert leg.; hand caught; JV_Prel_0059 ( RBINS) . • 1 ♀; West Flanders, Ypres, De Triangel , Urban park (bushes); 50.8418 ° N, 2.8838 ° E; ca 20 m a. s. l.; 28 May- 18 Jun. 2022; Fons Verheyde leg.; Malaise trap; JV_Prel_0058 ( RBINS) GoogleMaps . • 1 ♀; same collection data as for preceding 20 Aug. - 3 Sep. 2022; JV_Prel_0053 ( RBINS) GoogleMaps . • 1 ♀; same collection data as for preceding 17 Sep. - 1 Oct. 2022; JV_Prel_0055 ( RBINS) GoogleMaps . • 15 ♀♀, 8 ♂♂; West Flanders, Ypres, De Triangel , Urban park (pool vegetation); 50.8427 ° N, 2.884 ° E; ca 20 m a. s. l.; 6–20 Aug. 2022; Fons Verheyde leg.; Malaise trap; females - JV_Prel_0111 ( RBINS), JV_Prel_0112 ( RBINS), JV_Prel_0113 ( RBINS), JV_Prel_0114 ( RBINS), JV_Prel_0115 ( RBINS), JV_Prel_0116 ( RBINS), JV_Prel_0117 ( RBINS), JV_Prel_0118 ( RBINS), JV_Prel_0119 ( RBINS), JV_Prel_0120 ( RBINS), JV_Prel_0121 ( RBINS), JV_Prel_0122 ( RBINS), JV_Prel_0123 ( RBINS), JV_Prel_0124 ( RBINS), JV_Prel_0125 ( RBINS); males - JV_Prel_0103 ( RBINS, JV_Prel_0104 ( RBINS), JV_Prel_0105 ( RBINS), JV_Prel_0106 ( RBINS), JV_Prel_0107 ( RBINS), JV_Prel_0108 ( RBINS), JV_Prel_0109 ( RBINS), JV_Prel_0110 ( RBINS) GoogleMaps . • 8 ♀♀, 10 ♂♂; same collection data as for preceding 20 Aug. - 3 Sep. 2022; females - JV_Prel_0095 ( RBINS), JV_Prel_0096 ( RBINS), JV_Prel_0097 ( RBINS), JV_Prel_0098 ( RBINS), JV_Prel_0099 ( RBINS), JV_Prel_0100 ( RBINS), JV_Prel_0101 ( RBINS), JV_Prel_0102 ( RBINS); males - JV_Prel_0085 ( RBINS), JV_Prel_0086 ( RBINS), JV_Prel_0087 ( RBINS), JV_Prel_0088 ( RBINS), JV_Prel_0089 ( RBINS), JV_Prel_0090 ( RBINS), JV_Prel_0091 ( RBINS), JV_Prel_0092 ( RBINS), JV_Prel_0093 ( RBINS), JV_Prel_0094 ( RBINS) GoogleMaps . • 5 ♀♀, 9 ♂♂; same collection data as for preceding 3–17 Sep. 2022; females - JV_Prel_0068 ( RBINS), JV_Prel_0069 ( RBINS), JV_Prel_0070 ( RBINS), JV_Prel_0071 ( RBINS), JV_Prel_0072 ( RBINS); males - JV_Prel_0061 ( RBINS), JV_Prel_0062 ( RBINS), JV_Prel_0063 ( RBINS), JV_Prel_0064 ( RBINS), JV_Prel_0065 ( RBINS), JV_Prel_0066 ( RBINS), JV_Prel_0067 ( RBINS), ZFMK -HYM-00039673 , ZFMK -HYM-00039672 GoogleMaps .

Denmark • 4 ♂♂; Southern Jutland, Rømø ; 24 Sep. 2000; Torkhild Munk leg.; NHRS - HEVA 000023146 View Materials ( NHRS), NHRS - HEVA 000023147 View Materials ( NHRS), NHRS - HEVA 000023148 View Materials ( NHRS), NHRS - HEVA 000023149 View Materials ( NHRS) . • 1 ♀; Western Jutland, Baldersbaek , plantation; 12 Jul. 1993; Torkhild Munk leg.; NHRS - HEVA 000023150 View Materials ( NHRS) .

Germany • 1 ♀; Baden-Württemberg, Karlsruhe, Malsch, Luderbusch , south faced slope; 48.9131 ° N, 8.3325 ° E; ca 120 m a. s. l.; 26 Jul. - 2 Aug. 2020; Dieter Doczkal | K. Grabow leg.; Malaise trap; ZFMK -TIS-2640695 GoogleMaps . • 1 ♂; Bavaria, Allgäu, Balderschwang, Leiterberg ; 47.4858 ° N, 10.0899 ° E; ca 1290 m a. s. l.; 4–21 Sep. 2017; Dieter Doczkal | Johannes Voith leg.; Malaise trap; ZFMK -TIS-2640708 GoogleMaps . • 1 ♀; Berlin, Berlin, Chausseestraße 109, ruderal area; 29 Jun. - 5 Jul. 2009; A. Wiesener | V. Richter | F. Koch leg.; MfN URI: 57384 a ( ZHMB) . • 1 ♀; Hesse, Gießen, Botanical garden ; 50.5859 ° N, 8.678 ° E; ca 170 m a. s. l.; 18 Jun. 2021; GBOL III leg.; sweep net; ZFMK -TIS-2629491 GoogleMaps . • 1 ♂; Hesse, Rheingau-Taunus, Lorch am Rhein, oberhalb der Burg Nollig ; 50.0491 ° N, 7.7978 ° E; ca 240 m a. s. l.; 21–27 Jul. 2013; Oliver Niehuis leg.; Malaise trap; ZFMK -TIS-2629579 GoogleMaps . • 1 ♂; Hesse, Rheingau-Taunus, Lorch am Rhein, oberhalb der Burg Nollig ; 50.0498 ° N, 7.7974 ° E; ca 260 m a. s. l.; 15–21 Jul. 2013; Oliver Niehuis leg.; Malaise trap; ZFMK -TIS-2629514 GoogleMaps . • 2 ♂♂; same collection data as for preceding 21–27 Jul. 2013; ZFMK -TIS-2629242 , ZFMK -TIS-2629526 GoogleMaps . • 5 ♂♂; Hesse, Werra-Meißner-Kreis, Großalmerode, Private garden, Siedlerweg , semi-abandoned garden with wet spot, ivy hedge and salix; 51.2591 ° N, 9.7871 ° E; ca 380 m a. s. l.; 12–20 Jul. 2022; Jonathan Vogel leg.; Malaise trap; ZFMK -TIS-2640700 , ZFMK -TIS-2640701 , ZFMK -TIS-2640702 , ZFMK -TIS-2640703 , ZFMK -TIS-2640705 GoogleMaps . • 2 ♀♀; North Rhine-Westphalia, Bonn, ZFMK garden , lawn and bushes; 50.7218 ° N, 7.1132 ° E; ca 70 m a. s. l.; 30 Aug. 2022; AG Hymenoptera leg.; sweep net; ZFMK -TIS-2640698 , ZFMK -TIS-2640699 GoogleMaps . • 1 ♀; same collection data as for preceding 1 Sep. 2022; ZFMK -HYM-00039670 GoogleMaps . • 1 ♀; North Rhine-Westphalia, Rhein-Sieg-Kreis, Alfter, Mirbachstrasse ; 50.7307 ° N, 7.0142 ° E; ca 90 m a. s. l.; 22 Jul. 2021; GBOL III leg.; sweep net; ZFMK -TIS-2629298 GoogleMaps . • 1 ♀; North Rhine-Westphalia, Rhein-Sieg-Kreis, Schladern near Windeck, Sieg river , right river bank; 50.8 ° N, 7.585 ° E; ca 130 m a. s. l.; 20–27 Jun. 2017; ZFMK et al. leg.; Malaise trap; ZFMK -TIS-2629283 GoogleMaps . • 1 ♀, 2 ♂♂; same collection data as for preceding 18–25 Jul. 2017; female - ZFMK -TIS-2629289 ; males - ZFMK -TIS-2629485 , ZFMK -TIS-2629568 GoogleMaps . • 2 ♂♂; Rhineland-Palatinate, Ahrweiler, Niederzissen, Bausenberg , slope of volcanic mountain, mixed broad-leaved forest; 50.4679 ° N, 7.2223 ° E; ca 330 m a. s. l.; 12–27 Jul. 2022; Santiago Jaume Schinkel leg.; Gressitt Malaise trap; ZFMK -HYM-00039687 , ZFMK -HYM-00039688 GoogleMaps . • 1 ♂; Rhineland-Palatinate, Ahrweiler, Niederzissen, Bausenberg , upper part of volcanic mountain, next to oak tree; 50.4672 ° N, 7.2212 ° E; ca 310 m a. s. l.; 12–27 Jul. 2022; Santiago Jaume Schinkel leg.; Gressitt Malaise trap; ZFMK -HYM-00039671 GoogleMaps . • 1 ♂; Saxony, Leipzig, surroundings of Naunhof ; 28 Jul. 1957; Michalk leg.; JV_Prel_0046 ( SDEI) .

The Netherlands • 1 ♀; Gelderland, Beek-Ubbergen, Goudenregenstraat , garden; 51.8268 ° N, 5.9332 ° E; ca 10 m a. s. l.; 1 Oct. 2023; Jochem Kühnen leg.; hand caught; ZFMK -HYM-00039657 GoogleMaps . • 1 ♂; Gelderland, Nijmegen, Gelderse poort ; 10 May 2022; R. Lexmond leg.; Malaise trap; JV_Prel_0043 ( RBINS) . • 1 ♀, 7 ♂♂; same collection data as for preceding 20 Jul. 2022; female - JV_Prel_0077 ( RBINS); males - JV_Prel_0078 ( RBINS), JV_Prel_0079 ( RBINS), JV_Prel_0080 ( RBINS), JV_Prel_0081 ( RBINS), JV_Prel_0082 ( RBINS), JV_Prel_0083 ( RBINS), JV_Prel_0084 ( RBINS) . • 1 ♀; same collection data as for preceding 23 Aug. 2022; JV_Prel_0060 ( RBINS) .

Portugal • 1 ♂; Madeira, Funchal, Curral das Romeiros ; ca 550 m a. s. l.; 8 Feb. 1991; Martti Koponen leg.; specimen in coll. Koponen.

Sweden • 1 ♂; Dalarna, Rättvik, Glostjärn ; 20 May- 30 Jun. 1977; Tord Tjeder leg.; NHRS - HEVA 000023151 View Materials ( NHRS) . • 1 ♀; Hälsingland, Älgesjön ; 62.16 ° N, 16.212 ° E; ca 300 m a. s. l.; 17 May- 15 Jun. 2002; Erik Sahlin leg.; window trap; Tömn 1, specimen in coll MF GoogleMaps . • 1 ♂; Närke ; 10 Aug. 1953; Anton Jansson leg.; NHRS - HEVA 000023153 View Materials ( NHRS) . • 1 ♂; Närke, Oset ; 8 Aug. 1941; Anton Jansson leg.; NHRS - HEVA 000023152 View Materials ( NHRS) . • 1 ♂; Öland, Kastlösa ; 26 Jun. 1962; Karl-Johan Hedqvist leg.; NHRS - HEVA 000023175 View Materials ( NHRS) . • 1 ♀; Öland, Mörbylånga kommun, Skogsby , Ecological research station, lawn in garden with sandy soil; 56.6283 ° N, 16.4918 ° E; ca 30 m a. s. l.; 29 Aug. - 11 Sep. 2008; Swedish Malaise Trap Project (Swedish Museum of Natural History) leg.; Malaise trap; NHRS - HEVA 000023174 View Materials ( NHRS) GoogleMaps . • 1 ♂; Östergötland, S: t Anna, Svensmarö, Sanningholmen ; 7 Aug. 1976; Gustaf Wängsjö leg.; NHRS - HEVA 000023176 View Materials ( NHRS) . • 1 ♂; Scania, Kristianstads kommun, Trunelän, Degeberga , Grazed meadow at alder stand along stream; 55.7746 ° N, 14.2156 ° E; ca 80 m a. s. l.; 1–13 Aug. 2019; Swedish Insect Inventory Programme ( SIIP), Station Linné leg.; Malaise trap; NHRS - HEVA 000023155 View Materials ( NHRS) GoogleMaps . • 1 ♂; Scania, Malmö kommun, Klagshamn, Limhamns kalkbrott , Limestone quarry ; 55.5694 ° N, 12.9267 ° E; ca - 50 m a. s. l.; 4–12 Jun. 2018; Swedish Insect Inventory Programme ( SIIP), Station Linné leg.; Malaise trap; NHRS - HEVA 000023154 View Materials ( NHRS) GoogleMaps . • 2 ♂♂; Södermanland, Trosa kommun, Hunga södergård 1, agricultural backyard, heavily eutrophicated, in tall grass near stable manure pile; 58.9207 ° N, 17.5212 ° E; ca 20 m a. s. l.; 16 May- 13 Jun. 2004; Swedish Malaise Trap Project (Swedish Museum of Natural History) leg.; Malaise trap; NHRS - HEVA 000023156 View Materials ( NHRS), NHRS - HEVA 000023157 View Materials ( NHRS) GoogleMaps . • 4 ♀♀, 3 ♂♂; same collection data as for preceding 9–19 Aug. 2004; females - NHRS - HEVA 000023158 View Materials ( NHRS), NHRS - HEVA 000023160 View Materials ( NHRS), NHRS - HEVA 000023161 View Materials ( NHRS), NHRS - HEVA 000023164 View Materials ( NHRS); males - NHRS - HEVA 000023159 View Materials ( NHRS), NHRS - HEVA 000023162 View Materials ( NHRS), NHRS - HEVA 000023163 View Materials ( NHRS) GoogleMaps . • 1 ♂; Södermanland, Väsbyön ; 11 Aug. 1950; Anton Jansson leg.; NHRS - HEVA 000023165 View Materials ( NHRS) . • 1 ♀; Uppland, Almunge, Harparbol ; 20 Jun. 1948; Olov Lundblad leg.; NHRS - HEVA 000023169 View Materials ( NHRS) . • 1 ♀, 1 ♂; Uppland, Älvkarleby, Båtfors , flood-regiment oldgrowth birch edge of pine forest; 60.4607 ° N, 17.3178 ° E; ca 40 m a. s. l.; 14 Jun. - 4 Jul. 2005; Swedish Malaise Trap Project (Swedish Museum of Natural History) leg.; Malaise trap; female - NHRS - HEVA 000023167 View Materials ( NHRS); male - NHRS - HEVA 000023166 View Materials ( NHRS) GoogleMaps . • 1 ♂; Uppland, Håbo kommun, Biskops-Arnö , elm grove; 59.6721 ° N, 17.5009 ° E; ca 10 m a. s. l.; 27 Aug. - 10 Sep. 2004; Swedish Malaise Trap Project (Swedish Museum of Natural History) leg.; Malaise trap; NHRS - HEVA 000023168 View Materials ( NHRS) GoogleMaps . • 1 ♀; Uppland, Uppsala, Vårdsätra skog , forest; 7–28 Oct. 2002; Fredrik Ronquist leg.; Malaise trap; specimen in coll MF . • 2 ♂♂; Västerbotten, Hällnäs ; 22 Aug. 1961; Karl-Johan Hedqvist leg.; NHRS - HEVA 000023170 View Materials ( NHRS), NHRS - HEVA 000023171 View Materials ( NHRS) . • 1 ♀; Västergötland, South of Alingsås ; 29 Jul. 1998; Torkhild Munk leg.; NHRS - HEVA 000023172 View Materials ( NHRS) . • 1 ♀; Västmanland, Sala kommun, Västerfärnebo, Nötmyran ( Östermyran ), birch stand in moist haymaking meadow; 59.942 ° N, 16.3095 ° E; ca 70 m a. s. l.; 18 Aug. - 1 Sep. 2003; Swedish Malaise Trap Project (Swedish Museum of Natural History) leg.; Malaise trap; NHRS - HEVA 000023173 View Materials ( NHRS) GoogleMaps .

Switzerland • 1 ♀; Neuchâtel, Montmollin ; 1 Aug. 1966; Jacques de Beaumont leg.; specimen at MHNG . • 2 ♂♂; same collection data as for preceding 3 Aug. 1957; specimens at MHNG . • 1 ♂; same collection data as for preceding 17 Aug. 1962; specimen at MHNG . • 1 ♂; same collection data as for preceding 19 Aug. 1957; specimen at MHNG . • 2 ♂♂; same collection data as for preceding 31 Aug. 1956; specimens at MHNG . • 1 ♂; same collection data as for preceding 29 Sep. 1956; specimen at MHNG . • 1 ♀; St. Gallen, Pfäfers ; 9 Sep. 1992; F. Amiet leg.; specimen at NMBE . • 1 ♀; Valais, Visperterminen ; ca 1550 m a. s. l.; 4 Aug. 1996; Gerhard Bächli | Bernhard Merz leg.; specimen at NMBE . • 1 ♂; Vaud, Ferreyres ; 8 Sep. 1964; Jacques de Beaumont leg.; specimens at MHNG . • 1 ♀; Vaud, Lausanne, Vidy ; 9 Sep. 1948; Jacques Aubert leg.; specimens at MHNG . • 1 ♀; Vaud, Lutry ; 18 Jun. 1954; Jacques Aubert leg.; specimens at MHNG . • 1 ♂; Vaud, Rougemont ; ca 1000 m a. s. l.; 14 Jun. 1963; Claude Besuchet leg.; specimens at MHNG .

Biology.

Summer species, flying mainly from May to October, peak in July. Collected in all kinds of habitats: deciduous and coniferous forests, gardens, parks and orchards, agricultural fields, pastures and meadows, ruderal land, ponds and marshes

Distribution.

Verified by morphological examination: Belgium, Denmark, Germany (locus typicus of A. spheciformis ; locus typicus of A. fergussoni : Ingelheim am Rhein), Lithuania, The Netherlands, Norway, Portugal, Sweden (locus typicus of A. eucharioides : Västergötland), Switzerland, United Kingdom (locus typicus of A. tincta : unclear, either near London, Isle of Wight or Machynlleth (North Wales )).

CO 1 barcode sequence matches: Belarus (e. g. GMBMQ 746-17) and Canada (e. g. BBHYJ 932-10).

Lowland species, usually occurring in elevations below 500 m a. s. l., rarely collected in higher altitudes, most specimens between 0–100 m a. s. l.

Remarks.

A. eucharioides is both the most commonly collected and the most morphologically heterogeneous species within the genus Anacharis . Specimens often exhibit slight metallic sheen on their mesoscutum and head that is more notable in ethanol-stored specimens but sometimes retains on dried specimens.

The type of A. eucharioides is reportedly lost ( Fergusson 1986, Mata-Casanova et al. 2018), which we confirm herein by having searched the collection of the NHRS in addition to previous efforts at other possible depositories ( NHMUK, MZLU). In the current situation with several new species, we disagree with Fergusson’s statement, that “ … there is no confusion about the identity of this species ” and that “ a neotype is not required ” ( Fergusson 1986) and rather stress the necessity to designate a neotype from the broader type locality at Västergötland. However, as we were not able to acquire a fresh specimen suitable for DNA sequencing from the type locality, we withhold taking action until a more suitable occasion.

The lectotype of A. tincta is glued to its ventral side on cardboard, face down, the wings also glued to the board. It is overall intact, except the terminal four segments of the left antenna, which are detached from the rest to the specimen but still present on the cardboard. Also, the left fore tarsomeres are detached, the second tarsomere is missing, the rest is glued on the card. Both wings and legs obscure the lateral mesosoma on both sides. We here confirm the synonymy with A. eucharioides .

The lectotype of A. spheciformis (Hartig, 1840) was designated by Weld (1952), who reported the syntype series to consist of 12 specimens. Interestingly, Fergusson (1986) reports only one specimen under the name A. spheciformis from the Hartig collection, meaning that 11 syntypes might be lost. Fergusson additionally states the sex of the lectotype to be female, while the specimen is clearly a male. The species was treated as a synonym of A. typica by Dalla-Torre and Kieffer (1910) and Weld (1952), as established by Reinhard (1860), but the lectotype has a clearly sculptured mesoscutellum, which makes it distinct from A. typica . We agree with the latest treatments of A. spheciformis as synonym of A. eucharioides ( Fergusson 1986; Mata-Casanova et al. 2018) but as we consider A. typica a valid species, we formally move it from synonymy with A. typica to A. eucharioides .

A. fergussoni is diagnosed against A. parapsidalis and A. melanoneura in Mata-Casanova et al. (2018). The reason why it is not considered similar to A. eucharioides by the authors is likely due to the distinction they make based on the parascutal sulcus (present in A. fergussoni , absent in A. eucharioides ), as used in their key (couplet 3). As we found this character to be very variable within A. eucharioides , this is not sufficient for discrimination. The character states used to diagnose A. fergussoni against A. parapsidalis and A. melanoneura given by Mata-Casanova et al. (2018) match with the re-description of A. eucharioides by Mata-Casanova et al. (2018) and our observations. The morphometric values given for A. fergussoni fall into the range of A. eucharioides as diagnosed herein (Table 2 View Table 2 ), except the head width: length and the petiole length: metacoxa length which exhibit unusual high values in the description of A. fergussoni . However, the former is only 0.1 off of the range of A. eucharioides , and might well fall into the error range, and the latter (relative petiole length) seems erroneous in the description (“ about 2.0 times as long as metacoxa ” Mata-Casanova et al. 2018), as we measure a value of 1.4 on the images of the holotype, which falls well into the range of what we measured for A. eucharioides and is even close to the mean (1.0–1.7, mean 1.5). In terms of qualitative characters, the centrally sparsely pubescent to glabrous median lobe of the mesoscutum, the well-foveated notauli, the median carina of the mesoscutellum that is medially morphing into reticulate sculpture and the smooth to rugose lateromedial area of pronotum are typical for A. eucharioides . Based on this re-evaluation of possible morphometric differences and the similarity in qualitative characters between the specimens examined herein and the holotype of A. fergussoni we synonymise A. fergussoni with A. eucharioides .

We want to note that images of the holotype, kindly provided to kindly provided to us by the team at CNC, do not correspond to all the SEM images in Mata-Casanova et al. (2018, Fig. 4 A – C View Figure 4 ). Fig. 4 A View Figure 4 clearly shows the holotype before the right wings were removed, as does fig. 4 B though the image is vertically flipped, but fig. 4 C shows a different antennal position and must be a different specimen.

Here, we demonstrate that, given the morphometric variability within A. eucharioides and the whole eucharioides species group, morphometric characters / analyses cannot reliably separate this species from the others (Fig. 8 A View Figure 8 ). Our diagnosis rather relies on qualitative characters and species delimitation has been crucially informed by the results from analysis of molecular sequence data, which show a distinct cluster / putative species with small intraspecific variability based on almost 300 specimens from various localities. Without this reverse taxonomy approach included, finding and defining species limits within the eucharioides species group, and especially of A. eucharioides would have been difficult if not impossible.

Additional distribution records are listed in Mata-Casanova et al. (2018) for Andorra, France, Romania, Spain, Slovakia and Hungary. Since our circumscription of A. eucharioides is narrower than that of Mata-Casanova et al. (2018), we cannot confirm the presence of the species in these countries (specimens listed as A. eucharioides could also belong to A. typica or A. petiolata ) but it is likely present in these regions, too.

NHMUK

Natural History Museum, London

ZSM

Bavarian State Collection of Zoology

CNC

Canadian National Collection of Insects, Arachnids, and Nematodes

ZFMK

Zoologisches Forschungsmuseum Alexander Koenig

RBINS

Royal Belgian Institute of Natural Sciences

NHRS

Swedish Museum of Natural History, Entomology Collections

MHNG

Museum d'Histoire Naturelle

NMBE

Naturhistorisches Museum der Burgergemeinde Bern

MZLU

Lund University

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Hymenoptera

Family

Figitidae

Genus

Anacharis

Loc

Anacharis eucharioides (Dalman, 1818)

Vogel, Jonathan, Forshage, Mattias, Bartsch, Saskia B., Ankermann, Anne, Mayer, Christoph, von Falkenhausen, Pia, Rduch, Vera, Müller, Björn, Braun, Christoph, Krammer, Hans-Joachim & Peters, Ralph S. 2024
2024
Loc

Anacharis tinctus

Walker F 1835: 520
1835
Loc

Cynips eucharioides

Cynips eucharioides Dalman, 1818: 78
Loc

Megapelmus spheciformis

Megapelmus spheciformis Hartig, 1840: 202
Loc

Anacharis eucharoides

Anacharis eucharoides auct., common misspelling.