Anacharis maxima Vogel, Forshage & Peters, 2024
|
publication ID |
https://doi.org/ 10.3897/jhr.97.131350 |
|
publication LSID |
lsid:zoobank.org:pub:EA190992-B01B-4F1B-A362-A4549C725580 |
|
DOI |
https://doi.org/10.5281/zenodo.13517396 |
|
persistent identifier |
https://treatment.plazi.org/id/94B47FEC-2AE0-42C4-92E9-0B82C143488C |
|
taxon LSID |
lsid:zoobank.org:act:94B47FEC-2AE0-42C4-92E9-0B82C143488C |
|
treatment provided by |
|
|
scientific name |
Anacharis maxima Vogel, Forshage & Peters |
| status |
sp. nov. |
Anacharis maxima Vogel, Forshage & Peters sp. nov.
Figs 2 G View Figure 2 , 3 F View Figure 3 , 13 A – E View Figure 13
Diagnosis
(n = 6, all males). Belongs to the eucharioides species group. Large species (3.5–4.0, mean 3.8 mm, unique in Northwestern European fauna). Similar to A. eucharioides by having the lateromedial area of the pronotum smooth to rugose (Fig. 13 B View Figure 13 , smooth in A. minima , A. petiolata and A. typica , longitudinal carinae in A. martinae ). Differing from all other Northwestern European species by its large size (other species usually not larger than 3.5 mm), its mesoscutellar sculpture having oblique to transversal carinae only in the anterior half between the mesoscutellar foveae (Fig. 13 D View Figure 13 , smooth to entirely carinate or differently oriented carinae in other Northwestern European species) and having a LOL: metacoxa ratio of <0.225 combined with a head frontal height: mesoscutellum length ratio of ≤ 1.9 (Fig. 8 C View Figure 8 right, LOL: metacoxa ratio usually> 0.225, if around 0.225, then head frontal height: mesoscutellum length ratio> 1.9 in other Northwestern European species). In the Western Palaearctic fauna, A. maxima is most similar to A. parapsidalis , mainly due to its size. Anacharis parapsidalis was not reported from Northwestern Europe but from Japan and Romania ( Mata-Casanova et al. 2018). Anacharis maxima differs from A. parapsidalis in its mesoscutellar sculpture (Fig. 13 D View Figure 13 , mesoscutellum reticulate-carinate all over mesoscutellum in A. parapsidalis ), the lateromedial area of the pronotum is smooth to rugose (Fig. 13 B View Figure 13 , reticulate-carinate in A. parapsidalis ), the mesopleural line not reaching the posteroventral hypocoxal furrow (Fig. 13 B View Figure 13 ) (reaching it in A. parapsidalis ) and the presence of punctures on the metasomal tergites (absent in A. parapsidalis ).
Description.
Male. Size. Large; body: 3.5–4.0 (3.9) mm; antennae: 2.7–3.4 (3.1) mm; fore wing: 2.5–3.3 (3.3) mm
Colour. Body black (Fig. 13 A View Figure 13 ); scape, head, mesosoma, and metasoma entirely black (Fig. 13 View Figure 13 ); pedicel largely black (Fig. 13 C View Figure 13 ), flagellomeres bicoloured dorsoventrally (Fig. 13 A View Figure 13 ); mid and hind coxa, as well as hind femur largely (Fig. 13 A View Figure 13 ), fore coxa partially black (Fig. 13 A, B View Figure 13 ) and hind tarsomeres darkened (Fig. 13 A View Figure 13 ), otherwise yellow (Fig. 13 A View Figure 13 ); mandibles basally and apically darkened, otherwise yellow (Fig. 13 C View Figure 13 ); palps pale yellow (Fig. 13 C View Figure 13 ).
Head. Trapezoid in frontal view, genae abruptly kinked, meeting mandibular base in an angle <90 ° (Fig. 13 C View Figure 13 ); lower face with thick silvery hairs (Fig. 13 C View Figure 13 ), punctate; clypeal margin usually slightly bilobed, clypeus with central convex area, medially to medioventrally smooth (Fig. 13 C View Figure 13 ), otherwise punctate-rugulose; malar area coriaceous, reaching from ventral eye margin along entire stretch of mandibular base (Fig. 18 B View Figure 18 ), anteroventral corner of mandibular base sometimes smooth; genae smooth around eye, with increasingly dense punctation and regular setae towards the hind margin (Fig. 13 B View Figure 13 ); upper face setose, punctured, with usually noticeable, sometimes shallow median dent; space between toruli smooth (Fig. 13 C View Figure 13 ); eyes with few scattered setae (Fig. 13 C View Figure 13 ); vertex setose; POL: OOL: LOL: OD 2.2: 1.3: 0.8: 1 (2.3: 1.3: 0.8: 1), glabrous along OOL and anterior to median ocellus; head in dorsal view 2.0 times wider than long, laterally longer than medially; vertex and occiput usually with shallow median furrow, occiput broadly yet finely striate to striolate (Fig. 13 D View Figure 13 ), not interrupted by median furrow.
Antennae. ♂ formula:
2.1-2.4 (2.2): 1: 2.6-2.7 (2.7): 2.3-2.4 (2.4): 2.2-2.3 (2.2): 2-2.1 (2.1): 2-2.1 (2): 1.9-2.1 (1.9): 1.9-2 (1.9): 1.8-2 (1.9): 1.8-1.9 (1.8): 1.7-1.9 (1.8): 1.7-1.8 (1.7): 2-2.6 (2.5)
Mesosoma. Mesosoma 1.3 times longer than high (Fig. 13 B View Figure 13 ); pronotal plate centrally smooth, laterally coriaceous with a few carinae radiating from the centre, setose centrally and laterally, otherwise glabrous; pronotum laterally with dense silvery setae (Fig. 13 B View Figure 13 ), with longitudinal carinae along anterior margin, reaching hind margin in ventral region, lateromedial area slightly rugose, without regular carinae (Fig. 13 B View Figure 13 ); mesopleuron sometimes coriaceous dorsally and ventrally of mesopleural line, otherwise smooth (Fig. 13 B View Figure 13 ), scrobiculate along anteroventral margin (Fig. 13 B View Figure 13 ), reaching into venter; mesopleuron setose along ventral margin, otherwise glabrous (Fig. 13 B View Figure 13 ); mesopleural line separated from posteroventral hypocoxal furrow (Fig. 13 B View Figure 13 ), ventral margin somewhat continuous, dorsally marked by few to some influent striae (Fig. 13 B View Figure 13 ); mesopleural triangle separated from mesopleuron by carina that fades before reaching the posterior subalar pit (Fig. 13 B View Figure 13 ), posterodorsally smooth and shiny (Fig. 13 B View Figure 13 ); axillulae well delimited (Fig. 13 E View Figure 13 ), inside setose and longitudinally striolate; mesoscutum 1.1 times wider than long and 1.3–1.4 (1.3) times longer than the mesoscutellum (Fig. 13 D View Figure 13 ); notauli deep and distinct, with strong transversal carinae inside (Fig. 13 D View Figure 13 ), without (Fig. 13 D View Figure 13 ) or with fine wrinkles along them; median lobe of mesoscutum setose (Fig. 13 D View Figure 13 ), sometimes somewhat coriaceous, then lateral lobes also coriaceous, but less than median lobe; mesoscutellar foveae usually well delimited posteriorly by circumfoveal carinae (Fig. 13 D View Figure 13 ), fusing with median carina or not (Fig. 13 D View Figure 13 ); median carina starting to branch obliquely to transversally before reaching posterior end of foveae (Fig. 13 D View Figure 13 ), circumscutellar carina raised posteriorly (Fig. 13 D, E View Figure 13 ), appearing like a posterodorsal tooth on the mesoscutellum in lateral view; posterior surface of mesoscutellum medially broadly raised, evenly setose, ventrally scrobiculate, surface reticulate-striate (Fig. 13 E View Figure 13 ); dorsal axillular area striate on posterolateral margin, otherwise smooth (Fig. 13 D, E View Figure 13 ); nuchal collar broadly projecting dorsally, point rounded (Figs 6 F View Figure 6 , 13 E View Figure 13 ); fore trochanter, mid coxa and hind coxa with conspiciously long setae (Fig. 13 A View Figure 13 ).
Wings. Marginal cell of fore wing 2.6–2.9 (2.6) times longer than wide (Fig. 2 E View Figure 2 ); WIPs (Fig. 2 E View Figure 2 ): apical spot of hind wing narrow, covering less than half of the apical area.
Metasoma. 1.3 times longer than rest of body (Fig. 13 A View Figure 13 ); gaster twice as long as petiole (Fig. 13 A View Figure 13 ); petiole 1.3–1.5 (1.5) times longer than hind coxa (Fig. 13 A View Figure 13 ); metasomal tergite 2 (T 2) with two setae dorsolaterally on each side along weak band of punctures; T 3 and T 4 with narrow bands of punctures, T 5 and T 6 with broad bands of punctures; T 7 medially without punctures, otherwise filled with punctures with long setae dorsally.
Male genitalia. Parameral plate basally widened, ventrally with basal tooth-like projections pointing inwards (Fig. 3 E View Figure 3 ).
Female. Unknown.
CO 1 barcode.
n = 7. Maximum intraspecific distance: 0 %. Minimum distance to closest species ( A. eucharioides ): 3.9 %. CO 1 barcode consensus sequence:
TATTTTATACTTTATTTTAGGTATTTGATCTGGAATAATAGGATCAAGATTAAGAATAATTATTCGAAT AGAATTAGGGACCCCATCCCAATTAATTATAAATGATCAAATTTATAATTCAATTGTAACTGCACATGCA TTTATTATAATTTTCTTTATAGTTATACCTATCATAGTAGGAGGATTTGGAAATTATTTAGTACCTTTAA TATTAATTTCTCCTGATATAGCTTTCCCTCGATTAAATAATTTAAGATTTTGATTTTTAATCCCTTCCTT ATTTTTAATAACAATTAATTTATTTATTGATCAAGGGACAGGAACAGGATGAACTGTTTATCCCCCATTA TCATCCATCACAGGTCATCCATCTATATCAGTAGATTTAGTTATTTACTCATTACATTTAAGTGGAATTT CTTCAATTCTTGGATCAATTAATTTTATTGTAACCATTTTAAATATACGAATAATCTCCATATCTATAGA CAAAGTCTCATTATTTATTTGATCTATTTTTTTAACTACAATTTTACTATTATTATCTTTACCCGTACTA GCAGGAGGATTAACTATACTATTATTTGATCGAAATTTAAATACATCTTTTTTTGACCCTACAGGAGGAG GAGACCCTATTCTTTATCAACACTTATTT
Type material.
Holotype. Germany • ♂; Bavaria, Rhön-Grabfeld, Hausen, Eisgraben , basalt depot at forest margin; 50.5026 ° N, 10.0895 ° E; ca 740 m a. s. l.; 12–23 Jul. 2018; Dieter Doczkal leg.; Malaise trap; ZFMK -TIS-2640744 . GoogleMaps
Paratypes. Germany • 5 ♂♂; Same collection data as for holotype; ZFMK -TIS-2640739 , ZFMK -TIS-2640740 ( ZSM), ZFMK -TIS-2640741 ( SMNS), ZFMK -TIS-2640742 ( NHMUK), ZFMK -TIS-2640743 ( NHRS) GoogleMaps . • 1 ♂; Rhineland-Palatinate, Vulkaneifel, Jünkerath , private garden, wet meadow, right next to ditch; 50.3343 ° N, 6.595 ° E; ca 450 m a. s. l.; 6–8 Aug. 2021; Jonathan Vogel leg.; Malaise trap; ZFMK -TIS-2640676 GoogleMaps .
Other material examined.
Without DNA barcode. Sweden • 1 ♂; Uppland, Norrtälje, Singö ; 15 Jul. 1962; Karl-Johan Hedqvist leg.; NHRS - HEVA 000023177 View Materials ( NHRS) .
Switzerland • 1 ♂; Vaud, Aigle, Solalex ; 4 Aug. 1954; Jacques Aubert leg.; specimen at MHNG .
Biology.
Summer species, flying from July to August, peak in July. No clear preferences in terms of habitat.
Distribution.
Germany (locus typicus : Bavaria, Rhön-Grabfeld, Hausen, Eisgraben), Sweden, Switzerland.
No DNA barcode matches with publicly available sequences from other countries.
Probably preferring higher altitudes, as all specimens were collected at 400 to 800 m a. s. l.
Etymology.
From the latin word “ maximus ”, meaning the greatest, referring to the tall size of the species.
Remarks.
A. maxima is not frequently collected, though with six specimens caught from one collection event at one site, it seems like it can be locally relatively abundant. The diagnosis against A. parapsidalis is based on comparisons with the SEM images and the redescription ( Mata-Casanova et al. 2018) as no specimen of A. parapsidalis was available to us.
The morphometric analysis revealed only little overlap of A. maxima with the other species within the eucharioides species group (Fig. 8 C View Figure 8 left). The lda extractor provided two ratios, which – separately – can almost and – in combination – fully separate A. maxima from the remaining species (Fig. 7 View Figure 7 , Fig. 8 C View Figure 8 right). We included these ratios into the diagnosis of A. maxima . For this species, the morphometric analyses proved helpful in finding diagnostic characters. Note that this was not the case in A. eucharioides , and only partially in A. martinae (see above), highlighting both the morphometric variability and overall similarity of the Anacharis species and the power and applicability of multivariate morphometrics.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |