Catharylla coronata T. Leger & B. Landry

Leger, Theo, Landry, Bernard, Nuss, Matthias & Mally, Richard, 2014, Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae), ZooKeys 375, pp. 15-73 : 38-41

Catharylla coronata T. Leger & B. Landry sp. n. Figs 5, 19, 20, 38, 45

Type material.

Holotype. ♂, with labels as follows: "Col. BECKER | 81552"; "BRASIL:ES | Linhares, 40m | 20-29.ii.1992 | V.O.Becker Col"; "HOLOTYPE | Catharylla | coronata | Léger & Landry" [red label]. Deposited in Becker Collection.

Paratypes. 21 ♂, 4 ♀. BRAZIL: 5 ♂ with same data as holotype (1 used for DNA barcoding BC MTD 01890, 1 with genitalia on slide BL 1743); 2 ♂ with same data as holotype (1 used for DNA barcoding BC MTD 01891) except 05-09.iv.1992 (V. O. Becker n°82486); 6 ♂, 1 ♀ (1 ♂ with genitalia on slide BL 1730, ♀ with genitalia on slide BL 1731), Paranà, Rio Negro, 900 m, 8.ii.1973 (2 ♂), 10.ii.1973 (1 ♂), 11.ii.1973 (3 ♂), 13.ii.1973 (1 ♀) (A. & J. Razowski) (ISZP); 2 ♂, 2 ♀, Paranà, Curitiba, 920 m, 17.ii.1975 (1 ♂) (V. O. Becker n°10167), 20.ii.1975 (1 ♀, genitalia on slide BL 1756) (V. O. Becker n°10168), 12.iii.1975 (1 ♀, genitalia on slide BL 1753) (V. O. Becker n°10166), 10.x.1975 (1 ♂) (V. O. Becker n°4010) (Becker Coll.); 1 ♂ (genitalia on Pyralidae Brit. Mus. Slide No. 11357), Paranà, Castro, 950 m (E. D. Jones) (BMNH); 1 ♂, Paranà, Quatro Barras, 850 m, 27.ii.1970 (Laroca & Becker) (V. O. Becker n°15442) (Becker Coll.); 1 ♂ (genitalia on Pyralidae Brit. Mus. Slide No. 11337) Rio de Janeiro, Novo Friburgo (BMNH); 1 ♂ (genitalia on Pyralidae Brit. Mus. Slide. No. 19019) Sao Paulo, 700 m (E. D. Jones) (BMNH); 1 ♂, 1 ♀ (♂ with genitalia on slide BL 1774, ♀ with genitalia on slide BL 1736), Santa Catarina, Rio Vermelho, 968 m, 18.ii.1973 (♂), 28. ii. 1973 (♀) (A. & J. Razowski) (ISZP); 1 ♂, no locality data (V. O. Becker) (Becker Coll.).

COI barcode sequence of paratype BC MTD 01890 (654 bp): ACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGATCTCTTATTGGAGATGATCAAATCTATAATACTATTGTAACCGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTTCCCTTAATATTAGGAGCACCAGATATAGCTTTTCCTCGAATAAATAACATAAGATTTTGATTATTACCCCCCTCTTTAACTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATAGTGGAAGATCCGTAGATTTAGCAATCTTTTCCCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATCAATAATCTTTCATTTGATCAAATACCTCTTTTTGTTTGATCAGTAGGAATTACAGCTTTACTTCTTCTTTTATCATTACCAGTATTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCCGCAGGAGGAGGAGATCCTATTTTATATCAACATTTA

Diagnosis.

From Catharylla serrabonita and Catharylla tenellus , Catharylla coronata can be separated with characters of the male genitalia: the uncus is apically bifid and grooved on distal 1/5 in Catharylla coronata whereas it is only indented medially at apex in Catharylla serrabonita and Catharylla tenellus ; the costal arm of the valva is short and the apex is curved inward in Catharylla coronata whereas the costal arm is longer and points postero-dorsally in the other two species; the transtilla forms a pair of sclerotized arms slightly bent inward distally, ventrally with a row of short spines increasing in size from base to apex whereas it forms a pair of short, narrow sclerotized arms with pointed tips, projecting posterad, and with a pair of brushes directed medio-ventrally in Catharylla tenellus and a pair of sclerotized arms strongly bent inward on distal 1/4 and with a string of long spines of same length medially along it in Catharylla serrabonita ; the juxta is shorter than in Catharylla tenellus , and regularly narrowing toward apex whereas it is strongly narrowing on distal 1/4 in Catharylla serrabonita ; the ventral projections of the juxta form a pair of shallow pockets whereas they are bell-shaped in Catharylla serrabonita and thumb-like in Catharylla tenellus ; the vesica has a row of 6-7 cornuti in Catharylla coronata whereas it does not show any cornuti in Catharylla serrabonita and Catharylla tenellus . In the female genitalia of Catharylla coronata , the anterior angle of sternite VIII is not projected whereas it is rounded, projected anterad and covered with short spinules in Catharylla serrabonita , and projected downward in Catharylla tenellus . The anterior apophyses are quadrangular, anvil shaped whereas they are spine like in the other two species.

Description.

Male (n = 21) (Fig. 5): Head white with ochreous chaetosemata. Antenna brown, with whitish ochreous scales and patch of brown scales at base. Maxillary palpi light ochreous to ochreous, white tipped. Labial palpi: 1.6-1.85 mm long; light ochreous, white tipped. Thorax white, with ochreous patch at collar. Foreleg coxa white; femur white, dorsally dark brown; tibia and tarsomeres ochreous, distally ringed with brown; midleg and hindleg white to light ochreous, tarsomeres II–V ochreous, upperside brown, with white ringed tips. Forewing length: 10-13 mm; costal margin line thin, light ochreous, apically faded; median transverse line light ochreous, concave on costal half, more or less disrupted; subterminal transverse line ochreous, curving toward base on costal half; R5 vein faintly marked apically with ochreous; outer margin ochreous with 7 pronounced dark brown spots more or less triangular between veins, sometimes connecting; fringes brass colored; underside white ochreous to ochreous, costal margin basally brown; outer margin with pronounced spots. Hindwing white to creamy white, usually with marginal brown spots between Sc+R1, Rs, M1, M2, M3, CuA1 and CuA2, forming more or less continuous line; fringes white; underside light ochreous, with dark brown marginal spots pronounced.

Tympanal organs (n = 7): Transverse ridge more or less regularly rounded. Tympanic pocket extending faintly beyond transverse ridge, rounded. Tympanic drum glomerular, not reaching transverse ridge.

Male genitalia (n = 7) (Figs 19, 20): Uncus about 3/4 length of tegumen arms, downcurved; uncus arms basally with ventro-lateral tuft of setae; dorsal furrow pronounced medially with row of few setae on each side; thin, bifid on distal 1/5, slightly grooved, with apex slightly pointed; with shallow cavity ventro-apically. Gnathos arms connecting at 1/3 of length; shaft slightly downcurved, with apex pointing upward. Tegumen arms enlarging progressively toward uncus; tegumen connection about 1/3 arms length. Costa of valva basally narrow, with quadrangular projection, apically narrowing into arm pointing posterad with short tip curved inward; cucullus curved upward in distal 1/3, with apex rounded. Juxta triangular, regularly narrowing toward apex with shallow pockets projected ventro-laterally; with baso-lateral angles curved upward. Transtilla modified into two arms projecting posterad, slightly curved inward in distal 1/4, with longitudinal string of short spines ventrally at base, medially along arms, and at apex, increasing in size from base to apex in factor of about 1 to 4-5. Phallus almost straight, apex dorsally triangular; vesica basally covered with tiny spicules, microspicules barely visible all along vesica, also with row of 5-6 straight, short spine-like cornuti wider at their base.

Female (n = 4): Labial palpi: 1.6-2.2 mm long. Forewing length 14-16 mm. Frenulum triple.

Female genitalia (n = 4) (Fig. 38): Papillae anales straight, thick. Posterior apophyses 0.3-0.5 × length of papillae anales, wide at base, about half of length of papillae. Intersegmental membrane between segment VIII and IX covered with microspines. Sternite VIII laterally about 1/3 longer than tergite VIII. Sternite VIII formed by 2 lobes regularly narrowing downward into triangle, not connected ventrally, densely covered with spinules, with spinules longer ventrally. Anterior apophyses about 0.05 × length of papillae anales, quadrangular, anvil shaped. Anterior margin of sternite VIII latero-dorsally strongly sclerotized, thicker; posterior margin with dorsal line of setae. Sterigma membranous, covered with spinules. Ductus bursae regularly enlarging into corpus bursae, basally directed downward. Corpus bursae more or less rounded, faintly delimited from ductus bursae, with one oval signum.

Distribution.

The species occurs in Brazil in the following states: Bahia, Espirito Santo, Paranà, Rio de Janeiro, Santa Catarina, Saõ Paulo (Fig. 45).

Etymology.

The name comes from the latin coronatus, a, um: crowned, referring to the longitudinal string of short spines of the transtilla in the male genitalia.

Notes.

Based on our combined phylogenetic analysis, Catharylla coronata is the sister species of the Catharylla tenellus + Catharylla serrabonita pair (Fig. 42).