Heraclides rumiko Shiraiwa & Grishin

Shiraiwa, Kojiro, Cong, Qian & Grishin, Nick V., 2014, A new Heraclides swallowtail (Lepidoptera, Papilionidae) from North America is recognized by the pattern on its neck, ZooKeys 468, pp. 85-135 : 97-113

Taxon classification Animalia Lepidoptera Papilionidae

Heraclides rumiko Shiraiwa & Grishin sp. n. Figs 7-10, 11 a–d, 12 a–i, 12E part, 13 part, 14 part, 15 part, 16 part, 17 part, 18 part, 19 a–x, 20 a–r, 21 a–n, 22 a–j, 23 a–l

Description.

Male (n=95, Figs 7-8, 11a, 13 part) - holotype forewing length = 50 mm. Size on average smaller (mean forewing length 54 mm, maximum observed 58 mm) than Heraclides cresphontes . Wings typically narrower, less scalloped, and wing shape less variable than in Heraclides cresphontes , hindwing tail longer and narrower, weakly spoon-shaped. Ground color black to dark chocolate-brown. Dorsal forewing: Two maize-yellow bands: a central band of 9 spots from apex to basal third at inner margin in all cells from R3-R4 to 1A; and a sub-marginal band of 3 to 7 spots in cells from R4-R5 to CuA2-1A, absent or vestigial in most specimens anteriad of three cells between M3 and 1A veins. Several smaller maize-yellow spots near costa at the end of discal cell. Background-colored dark oval spot of variable size inside or at the anterior edge of the yellow central band spot in cell R5-M1, sometimes dividing the yellow spot into two. Marginal pale spots at dips between veins small or almost absent. Dorsal hindwing: Two maize-yellow bands extending from forewing: undivided into spots central band in wing basal third from costa to inner margin, with small tooth-like protrusions distad along veins Rs and M1; and sub-marginal band of 7 spots in cells from Sc+R1-Rs to CuA2-1A+2A, the tornal spots up to margin. Maroon-red to orange-red eyespot near tornus with blue crescent above. Center of the tail tip yellow. Ventral forewing: Yellow color paler; wider yellow central band weakly divided into spots from forewing costa to inner margin; submarginal band of 8 or 9 (spot near tornus may be divided into two) spots larger than on dorsal side in cells between veins R3 and 1A. Marginal pale spots at dips between veins larger than above. Discal cell yellow, overscaled with dark and with 5 variously developed dark longitudinal streaks. Ventral hindwing: Largely maize-yellow, a dark-brown rather straight discal band from costa through the end of discal cell to tornus with blue crescents inside in each cell and orange-red tornal spot distal to blue crescent. Distal end of discal cell with black (in some specimens blue) lines, often fused with the median band. Cells M2-M3 and M3-CuA1 orange-red at the base; few or no orange-red scales at the base of M1-M2 cell. Margin bordered black, with yellow edges along concavities. Dark-brown rays along veins between discal and marginal dark bands. Tail tip with yellow spot in the middle. Head and body: Antennae dark-brown, segments ringed with yellow beneath. Head and thorax dark-brown dorsally and yellow ventrally. Two longitudinal yellow stripes on head, patagia and tegulae forming two continuous yellow lines from head to thorax (Fig. 11a), only rarely and weakly separated into spots. Abdomen yellow, with a black dorsal stripe fading posteriad in many specimens. Male genitalia (n=34; Fig. 11 a–d, 14 part): Pseuduncus shaped as a tooth like, pointed projection flattened at the tip not extending posteriad beyond uncus, thus leaving a gap between the last tergum and valvae. In lateral view, pseuduncus dorsally flat but ventrally convex towards the tip. Uncus more slender than in Heraclides cresphontes , divided into two curved horn-like arms; each arm directed posterodorsad, curved laterad initially and then strongly mediad, narrowing to a point. Brachium arms from the base of uncus ventrad, narrow, shorter than uncus, directed posteroventrad and mediad, differently from uncus in dorsoventral projection. Both uncus and brachium visible in dorsal view (Fig. 11c). In Heraclides cresphontes brachium mostly covered by uncus (Fig. 11C). Valva somewhat square in shape, broadly rounded at the angles. Harpe oval, without long projections and spikes, finely dentate ventrad in posterior half, with apex curved inward. Distal end of harpe very close to the edge of valva, closer than in Heraclides cresphontes , and valva projects distad from the denticulate edge of harpe less than in Heraclides cresphontes , costa of valva usually broader than in Heraclides cresphontes . Aedeagus as long as the valva, straight and stout, no cornuti. Juxta U-shaped, gracile and smooth. Saccus short, barely protruding anteriad beyond vinculum.

Female (n=28, Figs 9-10): Similar to male but larger, with broader wings, ground color paler, yellow bands typically narrower and paler: cream-yellow on forewing and somewhat yellower on hindwing. Female genitalia (n=11, Fig. 12 a–i): Lamella postvaginalis tongue-shaped, ventrally convex smooth fig somewhat longer than wide, with rounded or slightly concave posterior margin, variable in width and length, lamella antevaginalis narrow, poorly sclerotized, laterally extending into narrow peripheral vestibular figs surrounding lamella postvaginalis on the sides up to its middle. Inner edge of each fig with short, tooth-like projection in some specimens (Fig. 12e). Antrum with two weakly sclerotized small figs along sides. Ductus bursae short, not longer than sterigma. Corpus bursae with a long longitudinal signum on ventral side.

Barcode sequence of the holotype.

Genbank accession KP173713, 658 base pairs:

AACATTATATTTTATTTTTGGAATTTGAGCAAGAATACTAGGAACTTCTCTTAGTTTACTAATTCGTACTGAATTAGGCA CCCCCGGCTCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAG TTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCCCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGACTTTTACCCCCTTCTCTAACTCTCCTAATTTCAAGAATAATTGTAGAAAATGGGGCAGGAA CTGGATGAACTGTTTACCCTCCTCTTTCCTCTAATATTGCCCATGGAAGAAGATCAGTAGATTTAGTTATCTTTTCTTTAC ATTTAGCTGGTATTTCCTCAATTCTTGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATTAATAGAATATCTT TTGATCAAATACCTTTATTTGTTTGAGCCGTAGGAATTACAGCTTTATTATTACTTTTATCTTTACCTGTTTTAGCAGGAG CTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCATTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATACC AACATTTATTT

In addition to the holotype, barcodes and ID tags were obtained for 110 paratypes: 93 full-length barcodes (658 to 664 bp), 3 partial barcodes (443 bp) and 14 ID tags (64 bp), see Suppl. material 1, GenBank accessions: KP173714-KP173823. Full length barcodes of paratypes revealed ten haplotypes differing from each other by just 1 to 3 base pairs (less than 0.5%, Fig. 17). The haplotype of the holotype was most frequently observed (67 sequences).

Type material.

Holotype: ♂, has the following three rectangular labels: white printed - || USA: TEXAS: Duval Co. | Benavides, CR306, 1.8 mi | W of SH339, 27.6075° −98.4415° | ovum collected 19-Apr-2014 | on Zanthoxylum fagara , adult ecl. | 30-May-2014 Grishin N.V. ||; white printed - || DNA sample ID: | NVG-2565 | c/o Nick V. Grishin ||; red printed - || HOLOTYPE ♂ | Heraclides rumiko Shiraiwa & Grishin ||. Pupal exuvia and larval head capsules are stored with the holotype. The holotype is illustrated in Figs 7-8, 19 a–d, v, & 23 a–c, and the Genbank accession for its DNA COI barcode sequence is KP173713. Upon publication, the holotype will be deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC (USNM). Paratypes: 94 ♂♂ and 28 ♀♀. Of these, 1 ♂ and 2 ♀♀ with the same data as the holotype, eclosion dates 26-, 27-, 29-May-14; DNA vouchers NVG-2559, -2563, -2564. USA: Texas: 28 ♂♂ and 6 ♀♀ Duval Co., along SH339, 1-5 mi SW Benavides, 19-Apr-2014, leg. N. V. Grishin & Q. Cong, DNA vouchers NVG-2335 –- 2339, -2425 –- 2453; Duval Co., SH359, 7.6 mi NE Benavides, 27°40.443' -98°19.209', ex larva, leg. N. V. Grishin, eclosed: 1 ♂ and 1 ♀ 16-Nov-2003, NVG-38, -2097; 1 ♂ 25-Nov-2003, leg. N. V. Grishin, NVG-2095; 2 ♂♂ 3-Jun-2004, leg. N. V. Grishin, NVG-2098, -2099; Cameron Co., E of Brownsville, Palmetto Hill Rd., leg. N. V. Grishin: 1 ♂ 11-Nov-1996, NVG-2102; ex larva, 1 ♀ 5-Dec-2007, NVG-2100; 1 ♀ Cameron Co., World Wildlife Management Area nr. Santa Maria, 14-Nov-1971, leg. R. O. Kendall & C. A. Kendall, NVG-2195 | NVG140320-36 [TAMU]; 1 ♀ Cameron Co., Las Palomas WMA, Tucker Unit, 24-Oct-2001, leg. J. & F. Preston, NVG-2238 | NVG140320-79; 1 ♂ Cameron Co., Brownsville, 1-Apr-1981, leg. C. Bordelon, NVG-2223 | NVG140320-64 [TAMU]; Hidalgo Co., Mission, 10th St. at irrigation ditch [TAMU]: 1 ♂ 2-Sep-1972, leg. W. W. McGuire, NVG-2164 | NVG140320-05; 1 ♂ 1 ♀ 8-Sep-1972, leg. R. O. Kendall & C. A. Kendall, NVG-2165, -2166 | NVG140320-06, -07; 2 ♂♂ Hidalgo Co., McAllen [TAMU]: 9-Oct-1973, leg. W. W. McGuire, NVG-2168 | NVG140320-09 [TAMU]; Valencia Motel, ex larva 21-Oct-1972, larval foodplant Ptelea trifoliata , leg. R. O. Kendall & C. A. Kendall, NVG-2167 | NVG140320-08 [TAMU]; 1 ♀ Hidalgo Co., Santa Ana National Wildlife Refuge, near Alamo, 13-Oct-1968, leg. R. O. Kendall & C. A. Kendall, NVG-2163 | NVG140320-04 [TAMU]; 1 ♂ San Patricio Co., SH 77 ca. 7 mi NNE of Sinton, Welder Wildlife Foundation, 10-Aug-1968, leg. R. O. Kendall & C. A. Kendall, NVG-2173 | NVG140320-14 [TAMU]; 1 ♀ San Patricio Co., 12.5 km NE Sinton @ SH 77, Welder Wildlife Foundation, 28.113, -97.418, 1-3-Jul-2002, J. C. Abbott & Field Entomology Class, NVG-2302 | NVG140403-30 [TMMC]; 1 ♂ Refugio Co., US Hwy 77 Mission River SW of Refugio, ex larva 17-Nov-1963, larval foodplant Zanthoxylum fagara , leg. R. O. Kendall & C. A. Kendall, NVG-2171 | NVG140320-12 [TAMU]; 1 ♂ Brazos Co., College Station, Riley Estate, 30.58849, -96.25366, 14-15-May-2011, leg. M. L. Riley, NVG-2243 | NVG140320-84 [Ed Riley]; 1 ♂ La Salle Co., 10.1 mi NW Artesia Wells, Chaparral Wildlife Management Area, 11-15-Jun-2001, J. C. Abbott & Field Entomology Class, NVG-2298 | NVG140403-26 [TMMC]; 1 ♂ Kinney Co., 7 mi along railroad W of Spofford, 8-Oct-1966, leg. R. O. Kendall & C. A. Kendall, NVG-2169 | NVG140320-10 [TAMU]; Val Verde Co., Old US90 at Devils River W of Del Rio, ex larva larval foodplant Ptelea trifoliata , leg. R. O. Kendall & C. A. Kendall [TAMU]: 1 ♂ 16-Sep-1968, NVG-2176 | NVG140320-17; 1 ♀ 8-Jun-1968 NVG-2175 | NVG140320-16; 1 ♂ Val Verde Co., Seminole Canyon State Historic Site, 26-May-2007, 29.696, -101.336, leg. J. C. Abbott & Field Entomology Class, NVG-2289 | NVG140403-17 [TMMC]; 1 ♂ Terrel Co, 15 air mi S Sheffield, Oasis Ranch, Independence Cr., 30.467, -101.801, 595 m, 23-27-May-2007, J. C. Abbott & Field Entomology Class, NVG-2290 | NVG140403-18 [TMMC]; 1 ♀ TX: Tom Green Co., San Angelo, 13-Jul-1986, leg. P. Goroy, NVG-14081G05 [CSUC]; 1 ♀ Kerr Co., Kerrville, Riverside Nature Center, 10-Oct-1998, leg. W. F. Chamberlain, NVG-2226 | NVG140320-67 [TAMU]; 1 ♂ Kimble Co., Junction, 9-Oct-1966, leg. W. F. Chamberlain, NVG-2231 | NVG140320-72 [TAMU]; 1 ♀ Van Zandt Co., 2.5 mi W Van, IH20 rest stop, 28-Jul-1996, leg. N. V. Grishin, NVG-2092; Culberson Co., Guadalupe Mnts. National Park [CSUC], 1 ♂ Choza Spr., 5000', 5-Jul-1986, leg. R. W. Holland & S. J. Cary, NVG-14081G12; 1 ♀ Pine Spring Cmpgr., 5700', 20-Jun-1986, leg. R. W. Holland, NVG-14081G11. USA: Colorado: 1 ♂ Logan Co., Sterling, 10-Jul-1970, leg. D. L. Munget, NVG-14081G09 [CSUC]. USA: New Mexico: 5 ♂♂ [CSUC]: Torrance Co., Manzano Mts., 3 mi E of New Canyon Cmpgr. 7400', 30-Jul-1968, leg. R. W. Holland, NVG-14081H02; Eddy Co., Last Chance Canyon, Sitting Bull Falls, 4600', 2-Sep-1986, leg. R. W. Holland & S. J. Cary, NVG-14081H09; Eddy Co., above Sitting Bull Falls, 4600', 20-Sep-1986, leg. R. W. Holland, NVG-14081H04; Eddy Co., Black River nr. Rattlesnake Spr., 3300', 19-Jul-1986, leg. R. W. Holland, NVG-14081H01; Hidalgo Co., Peloncillo Mts., Guadalupe Canyon, SW slope, 4600', 8-Sep-1985, leg. S. J. Carry, NVG-14081H05. USA: Arizona: 1 ♂ Maricopa Co., North Phoenix, 10-Aug-1974, | KS032; 1 ♂ Santa Cruz Co., Sycamore Canyon, 28-Aug-1977, leg. J. P. Brock, NVG-2109. USA: California: San Diego Co.: 1 ♀ San Diego, ex ovum 23-Sep-2012, eclosed 6-Nov-2012, leg. K. Shiraiwa, NVG-2505; 1 ♂ 1 ♀ Pauma Valley, 17-Jul-2011 & 25-Jun-2007, leg. K. Shiraiwa, NVG-2504, -2503; 1 ♂ 6762 Avenida Andorra, La Jolla, 2-Oct-1993, leg. J. Stoddard, | KS016; 1 ♂ Imperial Co., ovum collected 17-Apr-1962, adult eclosed 13-Jul-1962, | KS029. Mexico: Baja California Sur: 1 ♂ La Paz, Hotel Posada, 27-Sep-1970, leg R. W. Holland, NVG-14081G06 [CSUC]; 1 ♀ 2 mi N of San Pedro, 500', 27-Sep-1970, leg. R. W. Holland, NVG-14081G04 [CSUC]; 3 ♂♂ Buena Vista [SDMC], 1-Oct-1981, leg. D. Faulkner & F. Andrews, NVG-2572- -2574; 1 ♂ ibid, | KS017; 1 ♂ 48 mi S La Paz, 25-Aug-1982, leg. D. Faulkner & J. Brown, NVG- 2575. Mexico: Sonora: 1 ♂ 2 mi E San Carlos, 29-Jan-2003, leg. P. Opler, NVG-14081D10 [CSUC]; 1 ♀ Sonora, 5mi S of Yecora, 11-Aug-1991, NVG-2110; 1 ♂ Tepoca, 17-Sep-2010, | KS035 [SDMC]. Mexico: Sinaloa: 1 ♂ Panuco Rd. off Mx Hwy 40, 800', 29-Nov-3-Dec-2002, leg. Opler & Buckner, NVG-14081E04 [CSUC]; 1 ♂ Mexico: Sinaloa, Mx Hwy 40, nr. Jct. of Mx 15, 400', 30-Aug-1967, leg. R. W. Holland, NVG-14081H08 [CSUC]; 1 ♂ Mazatlan, 29-Dec-1974, NVG-2111. Mexico: Colima: 1 ♂ Colima, 5-Apr-1980, leg. P. Spade, | KS018 [SDMC]. Mexico: Durango: Tlahualilo, leg. C. S. Rude [TAMU]: 1 ♂ 19-Jul-1934, NVG-2232 | NVG140320-73, 1 ♀ 20-Aug-1935, NVG-2230 | NVG140320-71. Mexico: Coahuila: 1 ♂ Jct Hwy 57 & 53 south of Moncloya, 14-Sep-1977, leg. R. O. Kendall & C. A. Kendall, NVG-2180 | NVG140320-21 [TAMU]; 1 ♂ Cuatro Cienegas, 200 Ocampo St, Jul-1999, leg. A. Cohen, NVG-2284 | NVG140403-12 [TMMC]. Mexico: Nuevo Leon: 1 ♂ 28 km W Linares, 11-Apr-1979, leg. Schaffner & Friedlander, NVG-2240 | NVG140320-81 [TAMU]; 1 ♂ Hwy 60, ca 50 km WSW Linares, 2-Mar-1974, leg. R. O. Kendall & C. A. Kendall, NVG-2181 | NVG140320-22 [TAMU]; 1 ♂ ca 21 km WSW Cola de Caballo, 4 May 1978, leg. R. O. Kendall & C. A. Kendall, NVG-2182| NVG140320-23 [TAMU]. Mexico: Tamaulipas: 1 ♂ Gomez Farias, 500m, 19-Jul-1973, leg. Wm. McGuire, | KS019 [SDMC]; 1 ♀ Cd. Monte, Los Arcos Ct., 8-May-1978, leg. R. O. Kendall & C. A. Kendall, NVG-2185 | NVG140320-26 [TAMU]. Mexico: San Luis Potosí: 1 ♂ El Naranjo, 21-Feb-1976, leg. R. O. Kendall & C. A. Kendall, NVG-2183 | NVG140320-24 [TAMU]; 1 ♂ Hwy 70, 16 mi W Rioverde, 21-Feb-1980, R. O. Kendall & C. A. Kendall, NVG- 2184 | NVG140320-25 [TAMU]. Mexico: Morelos: 1 ♂ Rancho Viejo, 20-Jul-2008, | KS034 [SDMC]. Mexico: Veracruz: 1 ♂ Fortín de las Flores, Motel Posada Loma, 900 m, 30-Mar-1977, leg. R. O. Kendall & C. A. Kendall, NVG-2186 | NVG140320-27 [TAMU]; 1 ♂ Fortin 13-Aug-1970, leg. B. Douglas, | KS038 [SDMC]. Mexico: Oaxaca: 1 ♂ Tlalixtac, 5 mi N of Oaxaca, 6000', 13-IV-1988, leg. J. Kemner, NVG-2281 | NVG140403-09 [TMMC]; 1 ♂ Candelaria, Candelaria Loxicha, 1500', 29-IV-1988, leg. J. Kemner, NVG-2282 | NVG140403-10 [TMMC]; 1 ♂ km 190 near Zanatepec, 500 ft, 24-Jul-1987, #14813, NVG-14102H01 [FMNH]; 1 ♂ Yangul, 1-Apr-1979, leg. J. Stoddard, | KS012 [SDMC]. Mexico: Yucatan: 1 ♂ Merida, Mar-1976, | KS021 [SDMC]. Mexico: Quintana Roo: 1 ♂ X-Can, 21-May-1963, | KS022 [SDMC]. Honduras: 1 ♀ Escuela Agrícola Panamericana, 30 km SE Tegucigalpa, 1-May-1985, leg. Vascones, NVG-2221 | NVG140320-62 [TAMU]; 1 ♂ 1 ♀ in copula, 18 km west of La Ceiba, 27-Jul-1980, leg. R. D. Lehman, NVG-14061A06, -14061A07 [USNM]. El Salvador: 1 ♂ San Salvador, 26-Sep-1971, leg. M. Serrano, NVG- 14081G10 [CSUC]. Costa Rica: 1 ♂ Alajuela, Alajuela Adventist University of Centrali Americana, 15-20-May-1995, leg. J. C. Abbott & D. Petr, #308, NVG-2278 | NVG140403-06. Panama: 1 ♂ C. Z., La Pita, 19-Aug-1966, leg. G. B. Small, NVG-14061A05 [USNM].

Specimens excluded from the type series.

35 specimens from Texas (mostly central) possessed DNA barcodes of Heraclides rumiko , but many displayed morphological characters somewhat intermediate between those of Heraclides rumiko and Heraclides cresphontes . These specimens with full data are listed in Suppl. material 1 (as Heraclides rumiko , but not paratypes) and are excluded from the type series.

Type locality.

USA: Texas: Duval Co., Benavides, CR306, 1.8 mi west of SH339, latitude 27°36'27", longitude −98°26'29.4", elevation 124 m. This locality is at the sharp bend of the County Road 306, where several shrubs of Colima ( Zanthoxylum fagara [L.] Sarg.) are growing by a fence. The egg that developed into the holotype was found on one of these shrubs.

Etymology.

The species is named to honor the wife of the first author. Pronounced as 'roo(as in rue)-mee(as in meek)-koh(as in cod). The stress is on the first syllable. The name is a noun in apposition.

Distribution.

Heraclides rumiko is recorded from the southwestern United States (mostly southern regions of four states: CA, AZ, NM, and TX) to Panama (DNA barcode data obtained for specimens from Mexico, El Salvador, Honduras, Costa Rica, and Panama). The northernmost barcoded specimen is from northeastern Colorado. In Mexico, Heraclides rumiko tends to be absent from deserts and high mountains, but is found elsewhere ( Molina and León 2006). In central Texas, Heraclides rumiko is sympatric with its sister species Heraclides cresphontes . In Costa Rica and Panama, it is sympatric with Heraclides homothoas Rothschild & Jordan, 1906 ( Tyler et al 1994), a likely sister to the ancestor of Heraclides cresphontes and Heraclides rumiko .

In the 1960s, Heraclides rumiko began expanding its distribution in California northward, and by the 1980s, it has reached central California ( Emmel and Emmel 1973, Erickson and Iliff 2004). Citrus was cultivated in California from as early as 1840s ( Laszlo 2007), and the factors that prevented Heraclides rumiko from northward expansion for 120 years are unknown. The increase in ornamental citrus trees may have supported the buildup of Papilio rumiko numbers in southern California and the butterfly can now be commonly found in urban areas. Rue, another host, is very commonly cultivated in southern California today.

Diagnosis.

Heraclides rumiko belongs to the genus Heraclides Hübner, [1819] (type species Heraclides thoas ), because it possesses simple, smooth, U-shaped juxta, which is a synapomorphy for the genus. Heraclides rumiko is in the subgenus Heraclides Hübner, [1819] (type species Heraclides thoas ), because its uncus is shaped as two paired (i.e., uncus dorsad, brachium ventrad) horn-like processes, similarly to Heraclides thoas , and the harpe lacks a spine directed distad and separated at the end on its ventral surface. Heraclides rumiko is from the cresphontes group because the harpe is rounded, without sharp spines. These taxonomic attributions are also supported by the DNA barcode distances and trees (Fig. 15, 16). Heraclides rumiko differs from Heraclides melonius in lacking a knob-like blunt projection at the distal end of harpe and having restricted or absent orange scaling at the base of ventral hindwing cell M1-M2. Heraclides rumiko differs from Heraclides homothoas in having a simple beak-like, not bifid, pseuduncus. Compared to its sister species Heraclides cresphontes , Heraclides rumiko is characterized by (Figs 11, 13): (1) longer and more slender uncus arms, often strongly curving inwards; (2) brachium arms that project from the base of uncus on the inner (and not outer) side, and are visible below uncus in dorsal view, not hidden beneath uncus; (3) in lateral view, an uncus and brachium that point away from each other: posterodorsad (uncus) and posteroventrad (brachium), and not in the same direction; (4) bases of uncus and brachium that are weakly fused, with weaker sclerotization at the base of brachium; (5) two continuous yellow stripes dorsally from head to thorax, instead of separate spots; (6) more slender wings with longer tails; (7) smaller marginal yellow spots on the forewing; (8) a background-colored spot on yellow central band in cell R5-M1 that is larger, with better defined edges; (9) a submarginal forewing band mostly of 3 spots, not 4; (10) a black median band on ventral hindwing that is more expressed and straight; (11) a COI DNA barcode sequence that differs by about 3%. Seventeen positions are consistently invariant in either Heraclides rumiko or Heraclides cresphontes , but different between them on a sample of 183 Heraclides rumiko and 112 Heraclides cresphontes specimens across the range (Figs 17, 18, Suppl. material 1). These 17 positions are listed here in the format "k X (not Y)", where k is a sequential number of the position (numbering is from 1 to 658 for the barcode sequence of Heraclides rumiko holotype shown above), X is a nucleotide in Heraclides rumiko barcodes and Y is a nucleotide in Heraclides cresphontes barcodes: 10 T (not C), 19 T (not C), 79 C (not T), 82 C (not T), 106 T (not C), 223 T (not C), 235 T (not C), 238 T (not A), 286 C (not T), 287 C (not T), 319 A (not C), 340 C (not T), 364 C (not T), 433 A (not G), 616 C (not T), 628 A (not G), 640 T (not C). While these positions distinguish the two species in a sample of 295 specimens, some of the positions may show variation when a larger sample of sequence is accumulated.

Female genitalia are very variable in both species (Fig. 12), and we were not able to find differences between the two species. Also, due to significant variation in many characters, not all specimens might be readily identifiable, especially in central Texas, where Heraclides rumiko and Heraclides cresphontes likely hybridize at least to some extent as judged from intermediate characters in some specimens (Fig. 11E). Male genitalia, stripes on the neck and DNA barcodes are the most reliable characters for identification. Genitalia morphometrics involving 3 measures completely separates the two species (excluding specimens from central Texas) with a hiatus between them when a weighted sum of the 3 measures is used (Fig. 11E, along horizontal axis). None of the three measures is sufficient when used separately due to variation. The best of the three, the angle between uncus and brachium in lateral view, identifies all specimens but one. The failed specimen possesses brachium strongly curved dorsad, but other two measures in its genitalia correctly identify this specimen. Linear combination of the measures is more robust to variation than a single measure and should be used for more confident identification. Similar results were obtained with a combination of 4 facies measures, one of which was the continuity of the stripe on the neck (Fig. 11E, along vertical axis).

Life history, foodplants, and phenology

(Figs 19-24). The following observations were made in Texas and southern California. Eggs are laid singly on young leaves (Fig. 19 a) and shoots of the host plants from Rutaceae family: Zanthoxylum fagara [L.] Sarg, Ptelea trifoliata L., Amyris texana (Buckley) P. Wilson, and Casimiroa greggii (S. Watson) F. Chiang in Texas, or Ruta graveolens L. and Citrus spp. in both states, and likely others. For instance, ovipositions were recorded on Geijera parviflora Lindl. in Tucson, Pima Co., Arizona and females were observed around these trees in Los Angeles County, CA (Brian Banker, personal observations). Eggs are round, 1.1-1.6 mm in diameter, coated with a substance giving the surface a granular appearance (Fig. 19 b–j). Color of egg is pale yellow when laid, gradually changing to dull orange-brown. Heraclides rumiko eggs are typically smaller than Heraclides cresphontes eggs and are finer grained on the surface (Fig. 19 A–C). Eggs hatch in 7-10 days. Prior to hatching, larval head can be seen through the eggshell.

Larva eats egg shell upon hatching (Fig. 19k, l). 1st instar is 3-5 mm in length (Fig. 19 k–x), covered with prominent setae, head capsule yellow-brown with dark-brown spots and paler caret in the middle, body pattern resembles bird-droppings similarly to many other Papilionidae . Larva bears this pattern through the end of development, but it charges somewhat between instars. 2nd instar is 5-11 mm (Fig. 20 a–l), head from this instar on is uniformly brownish without darker spots. 3rd instar is 11-16mm (Fig. 20 k–r), 4th instar is 16-30.0 mm (Fig. 21 a–e), and 5th instar is 30-50 mm (Figs 21 f–n, 22 a–h). While the first 4 instars appear shiny, the 5th one is matte. Larval growth is rapid under indoor rearing condition with ambient room temperature, taking only about 9 days to reach ultimate instar. When a late instar larva is startled, it lifts its head and inflates the thorax, revealing the eyespots on meta-thorax (Fig. 22g). If disturbed further, it everts red osmeterium from behind the head. Early instar larva tends to use osmeterium right away when disturbed, and osmeterium of the first instar is yellowish. Right before pupation, the color of larva changes little, still resembling bird droppings (Fig. 22i, j), but becoming slightly more uniform and paler. Much more drastic prepupal color changes are observed in some other Papilionidae , such as Pterourus rutulus (Lucas, 1852) and Pterourus eurymendon (Lucas, 1852), whose larvae turn from green to brown ( Shiraiwa 2009). Since the larva is searching for suitable pupation sites on brown tree branches rather than green leaves, such color change is adaptive. Ultimate instar Heraclides larvae are already brown and rest on branches and not leaves to begin with. Heraclides cresphontes caterpillars (Figs 19 D–I, 20 A–K, 21 A–K, 22 A–K) are very similar to Heraclides rumiko , but most caterpillars are browner, more vividly colored and are less gray and less green, especially in the ultimate instar.

Pupa, 26-36mm in length (Fig. 23 a–l), is mottled pale to grayish and dark brown, resembling surface of a tree or branch it is attached to. Some pupae develop greenish-olive spots (Fig. 23 d–f). The darkness of a pupa is frequently determined by the color of the surface it rests on. E.g., the darkest pupa was formed on a dark branch (Fig. 23 g–i). The palest one (Fig. 23 j–l) is attached to a pale-green paper sheet covering the pupation container with the goal to induce a pale pupa. The pupa on a branch with greenish lichens developed the largest amount of green (Fig. 23 d–e). Heraclides cresphontes pupae are very similar, but are typically larger (Fig. 23 D–F), although poor foodplant condition could result in smaller pupae (Fig. 23 A–C). Adult either emerges from pupa in 1 to 2 weeks, or pupa goes into diapause for several months. Pupae overwinter. Pupae can be brought out of diapause prematurely with increase of temperature (Brian Banker, unpublished). Due to dark coloration of pupal wing cases, it is difficult to see when the adult is ready to eclose. The best indicator of pupae being near eclosion might be the dark stripe showing through the median on the dorsal side of an abdomen, which are usually paler and most transparent in pupae.

In south Texas (e.g., near the type locality in Duval County), Heraclides rumiko larvae are found on small to medium size Colima shrubs, Zanthoxylum fagara [L.] Sarg (Fig. 24 a–d) throughout ranches and particularly along the roads, which males use as flying corridors. Early instar larvae rest on leaves, ultimate instar caterpillars rest on branches, which they resemble in color. Adults can be found on wing during most of the year except the coldest months. Adults are more common from April to September, when emergences peak every 1.5 months with exact timing dictated by the severity of winter and the amount of rain. In southern California adults fly from late February through mid-November. In San Diego, California, the larvae are often found on citrus trees in gardens and orchards. The adults frequent the cities where many ornamental citrus plants grow, and the number of adults seen increases during August and September. Heraclides cresphontes in Texas uses Pepperwood Zanthoxylum clava-herculis L. (Fig. 24 A–D) as the major caterpillar host.