Heteranassa mima (Harvey, 1876)

Homziak, Nicholas, Hopkins, Heidi & Miller, Kelly B., 2015, Revision of the genus Heteranassa Smith, 1899 (Lepidoptera, Erebidae, Omopterini), ZooKeys 527, pp. 31-49 : 39-42

Taxon classification Animalia Lepidoptera Erebidae

Heteranassa mima (Harvey, 1876)

Homoptera mima Harvey, 1876: 155-156.

Eubolina mima ; Grote 1882: 42; Smith 1891: 63; 1893: 372.

Campometra mima ; Smith 1899: 104-105; Dyar 1903: 237.

Elousa mima ; Draudt and Gaede (in Seitz) 1923: 478.

Heteranassa mima (Harvey, 1876); Smith et al. 1903: 5; Barnes et al. 1917: 86; McDunnough 1938: 121; Kimball 1965: 130; Franclemont and Todd 1983; Poole 1989, 1996; Mustelin 2006: 7; Lafontaine and Schmidt 2010: 37.

Campometra fraterna Smith, 1899: 104, syn. n.; Dyar 1903: 236.

Heteranassa fraterna (Smith, 1899); Smith et al. 1903: 5; Barnes et al. 1917: 86; McDunnough 1938: 121; Kimball 1965: 130; Franclemont and Todd 1983; Poole 1989, 1996; Mustelin 2006: 7; Lafontaine and Schmidt 2010: 37.

Elousa fraterna ; Draudt and Gaede (in Seitz) 1923: 478.

Campometra minor Smith, 1899: 104-105; Dyar 1903: 236.

Elousa minor : Draudt & Gaede (in Seitz) 1923: 478.

Heteranassa minor (Smith, 1899), syn. n.; Smith et al. 1903: 5; Barnes et al. 1917: 86; McDunnough 1938: 121; Kimball 1965: 130; Franclemont and Todd 1983; Poole 1989, 1996; Mustelin 2006: 7.

Diagnosis.

This is the only species in the genus and can be diagnosed with the generic combination (see above).

Type material.

Heteranassa mima (Harvey, 1875). Holotype, (Fig. 13) ♀ in the Natural History Museum, London (BMNH) labeled: "Homoptera mima, type, Harvey, Holotype, 15/9, 73." The specimen and associated labels were examined through high-resolution photographs provided by the BMNH. Type locality: Texas [USA]

Heteranassa fraterna (Smith, 1899). Lectotype (Fig. 14) ♀ in USNM, designated by Todd (1982), labeled: "Death Valley, April '91 K., 677, 115 [circled], ♀ genitalia on slide, Sept. 21, 1938, J.F.G.C. #2035, Type No. 4313 U.S.N.M., Lectotype, Campometra fraterna , Smith, Genitalia slide U.S.N.M. 40478, Campometra fraterna , ♀ Cotype, Smith" Type locality: Death Valley [California, USA]

Heteranassa minor (Smith, 1899). Lectotype, (Fig. 15) ♀ in USNM labeled: " Campometra minor , ♀ type, Smith, Lectotype, Campometra minor , Smith, ♀ genitalia on slide, Sept. 21, 1938, J.F.G.C. #2035, Genitalia slide, U.S.N.M. 40477, Type No. 4314 U.S.N.M., U.S.N.M. Acc. no. 35005, Ariz., Collection G.D. Hulst." Type locality: Arizona [USA]

Description.

Adult male (Fig. 8): Head: scaling dark gray to gray-brown to tan; alternating uneven banding of white to light brown scales, and dark-brown scales, labial palpus concolorous with head and body, antenna scaling: each segment alternating light gray and dark brown. Thorax: dorsum dark gray to gray brown to tan; venter lighter grayish brown. Legs: dorsally concolorous with thorax, ventrally light gray with darker scales, tarsi alternating white and dark brown; tarsal segments alternating dark–brown to white scaling. Forewing: length as for genus description, basal line black; band of darker color runs vertically, adjacent to antemedial line, terminating where antemedia line points apically; area between medial and postmedial lines shaded darker, excluding reniform area; crenulations on margin of forewing with gray-white punctations. Hind wing: shaded gray brown from medial area distally; postmedial line complete, or faintly visible distally; subterminal line darker gray brown, outlined with light coloration distally. Abdomen: dorsum dark gray to gray brown to tan, laterally gray; venter gray, dusted with darker scales. Genitalia (Figs 3, 4) (24 dissections): Lateral processes at distal end of tegumen arms wavy; process at dorsal end fin shaped, very weakly sclerotized; ventral membrane on distal end weakly sclerotized; juxta with numerous short, pointed tubercles mesially, narrowed caudally; transtilla attached to costal parts of valve processes; vinculum with flared, fin-like processes directed anteriorly; sclerotized saccular process looping, connecting to costal region, “D” shaped; base of costa thumblike, connected to transtilla; aedeagus with dorsal surface undulating apically; vesical with five diverticula. Adult Female (Figs 9-15): forewing length as in genus description. Similar to male, except antennae filiform. Genitalia (Fig. 5) (12 dissections): Postvaginal plate narrowed anteriorly, densely covered in shark-tooth-like tubercles, caudal 7/8th outlined in stout setae; sterigma with sclerotized ridges laterally.

Variation.

Specimens tend to be larger in the eastern part of the range in Texas, and smaller specimens are more common in Arizona and California. Forewing coloration ranges from dark gray with some brown dusting to tan. Maculation ranges from well -defined antemedial, postmedial, and subcostal lines to lightly marked specimens with only the subcostal line well defined. Lightly marked specimens are found most commonly in the Mojave Desert. Ground color of hind wings is lighter towards the western range of the species. Specimens from the eastern part of the range show distinctly marked discal spots and shading on the margins on ventral surface of the wings, and the undersides are more heavily dusted with darker scales. The size of the white patch in the reniform area varies from a narrow dash to a large spot, while forewing ground color ranged from dark gray to gray brown among moths reared from the same female collected in Southeast Arizona.

Barcode variation in Heteranassa is very conservative. Examination of more than 160 full-sequence (658 base-pair) barcodes from California, Arizona, New Mexico, Texas, and northern Mexico showed a maximum divergence of less than 0.8%. One haplotype* dominated the sample, representing more than half of the specimens; the other barcodes included 36 haplotypes that had no more than two base-pair differences from each other. One haplotype, restricted to central and southern Texas, departed from this pattern in being 0.8% different from those from farther west. This is most probably the haplotype that should be associated with the name Heteranassa mima , it being described from this part of Texas. However, this “eastern” haplotype is found with “western” haplotypes in central Texas and there is no indication in genital structural characters, or wing color or pattern, that Heteranassa includes more than a single species. The barcodes of Heteranassa are so divergent that they give no indication of a close relationship to any other erebid genus, other than belonging in the subfamily Erebinae, tribe Omopterini . Heteranassa specimens from Texas and Mexico are frequently confused with some species associated with the genus Coxina Guenée, which can have a similar superficial pattern, but the barcodes are more than 10% different and the two genera do not appear to be closely related. (D. Lafontaine pers. comm.).

*CNCNoctuoidea13382 [Baboquivari Mts., Pima Co., Arizona, USA]

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGTTTATTAATTCGTGCTGAATTAGGAAACCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTT TATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTCCCCTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTCTGATTATTACCCCCATCTTTAACTCTTTTAATCTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAACATTGCTCATAGAGGAAGATCAGTAGATTTAGCAATTTTCTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACTATTATCAATATACGATTAAATAGATTAATATTTGACCAAATACCTTTATTTGTTTGAGCTGTTGGTATTACTGCTTTTTTACTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATACTCTTAACAGATCGAAATTTAAATACTTCCTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTCTTTACCAACATCTATTT

Distribution and habitat.

Warm, arid habitats from California to Texas, northward to Oklahoma, and south as far as Oaxaca, Mexico (Fig. 16). A single specimen from Cartwright, Manitoba is in the LACM.

Discussion.

The variation in Heteranassa wing pattern and coloration is continuous, with many specimens appearing intermediate to the phenotypes described by Smith (1899) and Harvey (1876). Genitalic morphology does not, however, correlate with wing pattern differences. These observations suggest that Heteranassa contains a single, highly variable species, Heteranassa mima . Studies of another erebine genus, Catocala , have shown that pressure from avian predators may drive high levels of polymorphism in forewing pattern and coloration ( Ricklefs and O’Rourke 1975, Bond and Kamil 2002, Webster et al. 2009), and Heteranassa may be subject to similar evolutionary processes.

A series of Heteranassa from Death Valley, California collected in February, 2005, is the most variable in forewing pattern and coloration among the thousands of specimens observed to date. Heteranassa comprised roughly 90% of the moth specimens collected during this period, demonstrating that the genus is an abundant and likely ecologically important insect herbivore in North American desert biomes.

During the course of this research, we became aware of potential taxonomic affinities with the neotropical genera Elousa Walker (1857) and Coxina Guenée (1852). These genera have not been studied in a systematic framework since the turn of the 20th Century. A preliminary examination of male genitalia and wing pattern show significant overlap of characteristics between the genera. These three genera lack spines on the mesothoracic tibiae, and possess symmetrical male genitalia with membranous costal regions of the valves. These processes are larger in Heteranassa and Elousa albicans (Walker, 1857) than they are in Elousa schausi (Giacomelli, 1911) and the other Coxina species we have dissected. We have examined 10 species in these genera from the Caribbean and South America. Specimens belonging to this group that we collected in the Nicaraguan highlands appear more similar to Elousa schausi specimens from Argentina and Coxina specimens from Mexico, south Texas, and Florida, than they do to Caribbean Elousa or North American Heteranassa . Future research could test the monophyly of Coxina and Elousa with respect to Heteranassa , and how these genera speciated in North and South America and the Caribbean.