Kelottijaervia shannonae Tedersoo, 2024

Tedersoo, Leho, Magurno, Franco, Alkahtani, Saad & Mikryukov, Vladimir, 2024, Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes), MycoKeys 107, pp. 249-271 : 249-271

Kelottijaervia shannonae Tedersoo sp. nov.

Diagnosis.

Separation from other species of Kelottijaervia based on the ITS region (positions 212–239 taatgtgagtgcaggaaatattatgact; one mismatch allowed) and LSU (positions 600–619 ctttggggtggcggtcgctg; one mismatch allowed) as indicated in Fig. 6 .

Type.

eDNA sample TUE 100189 (holotype); eDNA sequence EUK 1202520 (lectotype); GSMc plot G 2836 Finland, subpolar Betula pubescens forest (soil sample TUE 000189 ) in Kelottijärvi , Finland, 68.60353 ° N, 21.74517 ° E .

Description.

Other sequences: EUK 1603540, (GSMc plot G 4196, Populus - Picea - Pinus forest soil in Kahvena , Estonia, 58.27991 ° N, 25.23165 ° E); EUK 1603663 (GSMc plot G 4406, mixed coniferous forest soil in Tarumaa, Estonia, 59.20745 ° N, 27.15333 ° E); EUK 1602832 (GSMc plot G 5828, Malus domestica orchard soil in Mooste, Estonia, 58.15335 ° N, 27.19642 ° E); and KP 889965 (coniferous forest soil in British Columbia, Canada) that was first isolated by Shannon H. A. Guichon ( Guichon 2015).

Etymology.

Kelottijärvi (Finnish) refers to type locality; and Shannon (English) refers to the first name of Shannon H. A. Guichon who collected the first materials belonging to this genus.

Notes.

Found in Estonia, Finland and Canada, with ITS and LSU sequences displaying up to 2 % and 1 % of differences, respectively.

Figures

Figure 6. Diagnostic barcodes for Kelottijaervia shannonae relative to closely-related taxa in ITS 2 and LSU.