Kolla medsimilis Feng & Zhang

Feng, Ling & Zhang, Yalin, 2017, Two new species in the genus Kolla Distant (Hemiptera: Cicadellidae: Cicadellinae) from China, with DNA barcoding data, Zootaxa 4250 (2), pp. 191-197 : 192-195

publication ID	https://doi.org/ 10.11646/zootaxa.4250.2.5
publication LSID	lsid:zoobank.org:pub:10125F12-A8DC-4915-98FC-F8FB8FC08672
DOI	https://doi.org/10.5281/zenodo.6028621
persistent identifier	https://treatment.plazi.org/id/747D8789-FFAA-944F-08F1-C402408DFD85
treatment provided by	Plazi
scientific name	Kolla medsimilis Feng & Zhang
status	sp. nov.

Treatment

Kolla medsimilis Feng & Zhang View in CoL sp. nov.

( Figs. 1 View FIGURE 1 A–D, 2A–H)

Material examined. Holotype: ♂, China, Xizang Autonomous Region (Tibet), Linzhi, Bomi, Bolonggong , 80K, 15 June 2015, coll. by Zhai Qing with Malaise trap ; Paratype: 1 ♂, same data as holotype .

Measurement. Length of male 6.3–6.5mm

Description of male. Crown pale yellow, anterior margin broadly round, with extremely large irregular black medial marking and extending to face; face pale yellow, anterior margin with pair of black spots and small median spot, clypeal muscle impressions indistinct, postclypeus with rectangular black medial spot, anteclypeus with small irregular black marking; pronotum black with narrow transverse wavy pale yellow line near anterior margin; scutellum black with a V-shaped pale yellow spot at apex; forewing black except for exceedingly narrow transparent stripe next to costal margin. Male pygofer side not strongly produced posteriorly, significantly shorter than plate, posterior margin broadly convex, with group of macrosetae on apical half of disk and dense microsetae on upper base of disk; ventral process arising basiventrally and extending posterodorsad, wide at base with group of stubby microsetae, gradually narrowing toward middle part, then becoming slender with dentate acute apex in lateral view. Connective center of arms and around apex of manubrium membranous; style wide with the base membranous, then acute at apex; plates subtriangular, longer than pygofer, both margins gently concave near midlength, with two columns of macrosetae at base and scattered microsetae. Aedeagus bent anterodorsad in lateral view, shaft with a pair of lobes, inner side of the lobe almost straight, outer side of the lobe significantly concave near midlength, inner side of apex of lobes slightly sclerotized, with protuberance, as long as lobes, between two lobes in caudoventral view.

Etymology. This new specific epithet is a combination of Latin words “med-” and “similis” referring to the aedeagal protuberance being as long as two lobes.

Female. Unknown.

Distribution. China (Xizang).

Molecular characters. Partial mitochondrial gene COI sequence with GenBank accession number: KX498028 View Materials . Material: 1♂, China, Xizang Autonomous Region, Linzhi , Bomi , Bolonggong , 80K, 15 June 2015, coll. Zhai Qing, Wang Baohai. The sequence is as follows:

CACAATGTATTTTATATTTGGTATCTGGGCAGGGATAATTGGCACAATACTAAGAATAATTATTCGTGTT GAATTAGCACAGCCTGGATCATTTTTAGGTAACGATCAATTATACAATGTAATTGTTACTTCTCATGCAT TTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGGGGTTTTGGTAATTGATTACTACCCCTTATAAT CGGTGCACCAGATATAGCATTTCCACGTATAAATAATATAAGATTTTGAATATTACCTCCCTCTATAGTTT TGTTGTTAGTTAGATCTCTTGTTGAATCAGGAGCAGGAACAGGTTGAACAGTTTACCCACCTCTATCTG GGAATATTGCTCATTCAGGAGCTAGAGTCGATTTAACAATCTTTTCCCTCCACTTGGCTGGAATTTCAT CCATCTTGGGGGCAGTTAATTTTATTACTACAGTAATTAATATACGAACAACTGGTATAAATTTGGATCG AACCCCCTTATTTGTTTGGTCAGTTATAATCACAGCTGTACTTTTACTTCTTTCCCTACCTGTTTTAGCA GGAGCAATCACAATATTATTAACAGACCGAAATATTAATACTAGTTTTTTTG

Remarks. This new species is similar to Kolla nigrifascia Yang & Li, 2000 , but it can be easily distinguished by the following characters: crown with extremely large irregular black spot covering almost the whole crown ( Figs 1 View FIGURE 1 A, 1C); male pygofer with posterior margin broadly convex, with a group of macrosetae on apical half of disk and dense microsetae scattering on upper base of disk ( Figs 2 View FIGURE 2 A, 2C); aedeagal shaft with pair of lobes, inner side of lobe almost straight, outside of lobe significantly concave near midlength, apex of lobes slightly sclerotized, with protuberance as long as lobes in caudoventral view ( Figs 2 View FIGURE 2 H, 2I). This new species is also similar to Kolla fusciosigna Yang & Li, 2002 , but it differs from the latter by the markings of the crown and face ( Figs 1 View FIGURE 1 A, 1C, 1D); the broadly convex male pygofer posterior margin, with several macrosetae on the apical half and ventral and upper base of disk ( Figs 2 View FIGURE 2 A, 2C); and the apex of the aedeagal lobes poorly sclerotized ( Figs 2 View FIGURE 2 H, 2I).