Urbanus (Urbanus) mericuti Grishin, 2023
publication ID |
https://doi.org/ 10.5281/zenodo.10396362 |
DOI |
https://doi.org/10.5281/zenodo.10621987 |
persistent identifier |
https://treatment.plazi.org/id/03810139-FFD3-BB5D-C0CA-FB9DE7FFB0B1 |
treatment provided by |
Felipe |
scientific name |
Urbanus (Urbanus) mericuti Grishin |
status |
sp. nov. |
Urbanus (Urbanus) mericuti Grishin , new species
https://zoobank.org/ 5C620BB9-A60D-42F8-B72B-8C832D79A9D4
( Fig. 1 part, 19–20, 231–232)
Definition and diagnosis. Inspection of genomic trees reveals that most South American populations identified as Urbanus tucuti (R. Williams, 1927) (type locality in Panama, holotype sequenced as NVG-15095A10) are strongly differentiated genetically from U. tucuti ( Fig. 1): e.g., their COI barcodes differ by 3.5% (23 bp), and therefore represent a new species. It keys to “ Astraptes tucuti ” (C.14.5) in Evans (1952) and differs from it by comparatively shorter harpe with a straighter dorsal margin and less acute terminal angle, the wider separation between harpe and ampulla (wider notch) ( Fig. 232), uncus arms being more parallel to each other and closer together, rather than terminally diverging in dorsal view ( Fig. 231), and usually absent or reduced hyaline dash in M 3 -CuA 1 cell ( Fig. 19). Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly53.2.40:C42T, aly 1968.11.7:A106G, aly58.10.2:C13T, aly58.10.2:G45A, aly7098.1.5:C115A, and COI barcode: A43T, A79G, T178C, T479C, T601C.
Barcode sequence of the holotype. Sample NVG-14104A08, GenBank OR837629, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGTACTTCTTTAAGATTACTTATTCGAACTGAATTAGGGACTCCAGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCATTTATTATAATTTTCTTTATAGTTATACCTATCATAATCGGAGGATTTGGTAATT GACTTGTACCTTTAATAATAGGTGCCCCTGATATAGCTTTCCCCCGTATAAATAACATAAGATTTTGATTACTACCCCCTTCCTTAACTTTATTAAT TTCAAGAAGAATTGTTGAAAATGGTGCTGGTACTGGATGAACAGTTTATCCCCCCCTTTCATCTAACATTGCTCATCAAGGAGCTTCTGTTGATTTA GCAATTTTCTCTCTTCATCTTGCCGGAATTTCATCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAATAGACTAACTT TTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATT AACTGATCGAAATCTAAACACATCATTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution , Washington, DC, USA ( USNM), illustrated in Fig. 19–20, bears the following four rectangular labels, three white: [ ECUADOR: Napo Pr. | 8 km Napo-Ahuano | 1° 2.5′ S 77° 43.5′ W | 9 Nov. 1992, 480m. | S. S. Nicolay, leg.], [ Astraptes | Det. fulgor | S.S. Nicolay], [DNA sample ID: | NVG-14104A08 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Urbanus mericuti | Grishin] GoogleMaps . Paratypes: 4♂♂ in USNM: 1♂ NVG-14104A09 the same data as the holotype, except 13-Nov-1992 GoogleMaps ; Ecuador 1♂ NVG-8078 Napo, Misahualli Jungle Lodge , 450 m, GPS −1.0257, −77.6570, 6–8-Jan-2002, J. P. W. Hall and M. A. Solis leg., genitalia NVG170208-63 ( Fig. 231–232) GoogleMaps ; Brazil: 1♂ NVG-19071G06 Amazonas, Benjamin Constant , Nov-1960, Jorge Kesselring leg. ; 1♂ NVG-19071G06 Rondonia, 62 km S Ariquemes, Fazenda Rancho Grande , 165 m, GPS −10.533, −62.800, 14-25-Nov-1993, Brian Harris leg. GoogleMaps
Type locality. Ecuador: Napo Province, km 8 of Puerto Napo-Ahuano Road, elevation 480 m, GPS −1.0417, −77.725.
Etymology. The name denotes a more southern range of this species than U. tucuti : meri [dionalis (Latin for southern) + tu] cuti. The name is a noun in apposition.
Distribution. Currently known from the upper Amazonian region in Ecuador and Brazil.
USNM |
Smithsonian Institution, National Museum of Natural History |
V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |