Documenting trumpet leaf-miner moths (Tischeriidae): new Neotropical Coptotriche and Astrotischeria species, with notes on Sapindaceae as a host-plant family Author Stonis, Jonas R. Nature Research Centre and Baltic-American Biotaxonomy Institute, Akademijos St. 2, Vilnius 08412, Lithuania. Author Diškus, Arūnas 0000-0003-0106-5546 Nature Research Centre and Baltic-American Biotaxonomy Institute, Akademijos St. 2, Vilnius 08412, Lithuania. & diskus. biotaxonomy @ gmail. com; https: // orcid. org / 0000 - 0003 - 0106 - 5546 diskus.biotaxonomy@gmail.com Author Remeikis, Andrius 0000-0002-9310-1112 Nature Research Centre and Baltic-American Biotaxonomy Institute, Akademijos St. 2, Vilnius 08412, Lithuania. & remeikis. andrew @ gmail. com; https: // orcid. org / 0000 - 0002 - 9310 - 1112 remeikis.andrew@gmail.com Author Fernández-Alonso, José L. 0000-0002-1701-480X Real Jardín Botánico - CSIC, Claudio Moyano 1, Madrid 28014, Spain. & jlfernandeza @ rjb. csic. es; https: // orcid. org / 0000 - 0002 - 1701 - 480 X jlfernandeza@rjb.csic.es Author Baryshnikova, Svetlana V. 0000-0002-2549-4911 Zoological Institute, Russian Academy of Sciences, Universitetskaya nab. 1, St. Petersburg, Russia. & parornix @ zin. ru; https: // orcid. org / 0000 - 0002 - 2549 - 4911 parornix@zin.ru Author Solis, M. Alma 0000-0001-6379-1004 Systematic Entomology Laboratory, ARS, US Department of Agriculture, National Museum of Natural History, Smithsonian Institution, Washington, D. C., 20013 - 7012, USA. & alma. solis @ usda. gov; https: // orcid. org / 0000 - 0001 - 6379 - 1004 alma.solis@usda.gov text Zootaxa 2021 2021-09-30 5047 3 300 320 journal article 10.11646/zootaxa.5047.3.4 1175-5326 5540825 65A22984-EBA7-4788-B044-B23BC59939D4 Coptotriche serjaniphaga Remeikis & Stonis , sp. nov. urn:lsid:zoobank.org:act: 71EE7F8A-D544-41E7-829E-1D75743783E2 ( Figs. 11–18 ) Type material . Holotype : , PERÚ , Dept. Apurímac , Curahuasi , 13°32ꞌ02ꞌꞌS, 72°42ꞌ59ꞌꞌW, ca. 2700 m , mining larva 25.v.2018 , leg. Arotaype-Puma ( NRC ). Diagnosis. Externally, this new species is similar to the Peruvian C. carmencita Stonis & Diškus described and illustrated in Stonis et al . 2019a : figs. 23, 24, 57–62, 115–120). However, C. serjaniphaga sp. nov. is a significantly larger moth, 9 mm in wingspan ( C. carmencita , 5.6–5.8 mm ). Coptotriche serjaniphaga sp. nov. differs in the dark golden ochre forewing, thorax, and frontal tuft ( C. carmencita is a pale, entirely ochreous yellowish moth). In C. serjaniphaga , dark scales form two small, irregular, subapical spots; the tornal spot ( Fig. 15 ) is distinctive (in C. carmencita , forewing is irregularly speckled with dark scales which are especially abundant along the tornal margin of forewing). The host-plant genus Serjania Mill. (possibly S. squarrosa Radlk. ) is distinctive (see Discussion). Additionally, C. serjaniphaga sp. nov. has been discovered in temperate areas of the Peruvian Andes and C. carmencita occurs in the subtropical, humid habitats of the Peruvian “selva alta” which seems to be a transitional corridor between the montane regions and tropical lowlands, or the Amazonian selva or “selva baja”. Male ( Figs. 14, 15 ). Forewing length 4.25 mm ; wingspan 9.0 mm (n = 1). Head . Frons yellowish ochre; palpi golden cream; pecten brownish cream; frontal tuft glossy golden cream, laterally golden ochre; collar golden ochre; antenna distinctly longer than one half the length of forewing; flagellum pale grey, golden glossy, with relatively short, very fine, inconspicuous sensilla. FIGURES 1–6. Bionomics of Astrotischeria mystica Diškus & Stonis , sp. nov. 1–3, host plant Verbesina L. (possibly V. plowmanii Sagást. ) ( Asteraceae ), Urubamba Province, Peru, 2180 m; 4–6, leaf mines FIGURES 7–10. Bionomics of new Astrotischeria species. 7 , 8, leaf mines of A. yungasi Diškus & Stonis , sp. nov. ; 9, Oyedaea DC. , possibly O. boliviana (Lam.) King & Rob. (Asteraceae) , a host plant of A. yungasi sp. nov. , Bolivia, Nor Yungas Province, 1660 m; 10, a leaf mine of A. parapallens Diškus & Stonis , sp. nov. on Baccharis sp. , possibly B. latifolia (Ruiz & Pav.) Pers. (Asteraceae) , Ayacucho, Peru, 2510 m FIGURES 11–18. Astrotischeria serjaniphaga Remeikis & Stonis , sp. nov. 11–13, leaf mines on Serjania Mill. , possibly S. squarrosa Radlk. (Sapindaceae) , Curahuasi, Apurímac Department, central Peru, at an elevation of about 2700 m; 14, 15, male adult, holotype; 16–18 pupal exuviae (NRC) Thorax. Tegula, thorax, and forewing concolorous, glossy, dark golden ochre, sparsely speckled with dark greybrown scales; forewing with two small, irregular, subapical spots; the tornal spot is indistinctive ( Fig. 15 ); fringe ochre, with incomplete and inconspicuous fringe line comprised of dark brown scales; forewing underside grey, golden glossy, with weak purple iridescence, without spots or androconia. Hindwing pale grey to grey on upper side and underside, with weak purple iridescence, without androconia; fringe grey, ochre glossy. Legs pale yellow-ochre, dark grey to blackish grey on upper side. Abdomen lost. Female. Unknown. DNA barcode. We barcoded hind legs of the holotype . The aligned length of the dataset is 674 bp: AA- CATTATATTTTATTTTTGGTATGTGAGCAGGTATAGTAGGAACATCATTAAGATTATTAATTCGAG- CAGAATTAGGAACTGCAGGATCCTTAATTGGAGATGATCAAATTTATAACACTATTGTTACAGCCCAT- GC TTTTATTATAATTTTTTTTATA G TTAT GCC AATTATAATT GG A GG ATTT GG TAATT G ATTA G TTCCATTAATATTAGGTGCCCCTGATATAGCATTCCCCCGTCTTAATAATATAAGATTTTGATTAT- TACCTCCATCTTTATTACTTTTAATTTCCAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAA- CAGTATACCCCCCACTTTCATCAAATATTGCCCATACAGGAAGATCAGTAGATCTTGCTATTTTTTCC CTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATAATTAATATAC- GATCACAAGGAATATCATTTGATCAAATACCTTTATTCGTATGAGCAGTTGCAATTACAACAGTAT- TATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACAATATTATTAACAGATCGTAATTTAAA- CACATCTTTTTTTGATCCTGCTGGAGGAGGAGACCCTATTTTATATCAACATTTATTTTGATTTTTTGGT- CATC . Sequence is available in GenBank under voucher/sample ID OK017167 . Bionomics ( Figs. 11–13, 16–18 ). Host plant is Serjania Mill. , possibly S. squarrosa Radlk. (Sapindaceae) . Larvae mine leaves in May. The blotch mine ( Figs. 11–13 ) is irregular, white at the beginning, cream, transparent, with no or very little frass further along; fully developed mines usually bend (distort) the mined leaf ( Fig. 11 ). Pupation inside the leaf mine. Adults fly in June. Distribution . The species is known from the single locality, Curahuasi, Dept. Apurímac , central Peru , at an elevation of about 2700 m . Etymology . The species is named after the host-plant genus Serjania , Sapindaceae , a novel host-plant taxon for the Tischeriidae , combined with the Ancient Greek phago (eater, feeder). Remarks. Unpublished molecular data of mtDNA COI sequences provide strong support for this new species. In our unpublished molecular analysis of Tischeriidae , C. serjaniphaga sp. nov. always appeared as a very distinct, separate clade, close but not fully matching with Coptotriche . A phylogenetic tree will be published separately with a molecular analysis of Tischeriidae (Stonis et al. in prep.).