Megalothorax sanguineus, Schneider, Clement, Porco, David & Deharveng, Louis, 2016

Schneider, Clement, Porco, David & Deharveng, Louis, 2016, Two new Megalothorax species of the minimus group (Collembola, Neelidae), ZooKeys 554, pp. 37-68 : 47-57

Taxon classification Animalia Collembola Neelidae

Megalothorax sanguineus sp. n. Figs 8, 9, 10, 11, 12, 14C, D, 15, 16B

Material examined.

Type material. Holotype: female on slide (MNHN-EA040230), France: Midi-Pyrénées: Ariège: Suc-et-Sentenac: Vicdessos: on the edge of the Bernadouze peat-bog, mosses at a spring to the west under beech; lon= 1.4220°E; lat= 42.8024°N; alt=1360 m; 13.vi.2013; Berlese extraction, mosses, Lorène Marchal and Anne Bedos leg (09-BDZ1306-G03M) [MNHN]. Paratypes: 2 males and 4 females on slides (MNHN-EA040231-236), same data as the holotype [MNHN].

Other material.

4 females on slides (MNHN-EA040237-239]), France: Midi-Pyrénées: Ariège: Saint-Lary: Osque du Couret, forest litter on humid slopes; lon=0.8548; lat=42.8891; alt=1150 m; 28.vii.2010; Berlese extraction, litter, Louis Deharveng and Anne Bedos leg (09-761) [MNHN].

Diagnosis.

Reddish in alcohol. Absence of median integumentary protuberance in front of chaeta a0 on forehead. Presence of chaeta X on Ant. IV. Labium: basomedian fields with 3 + 3 chaetae, basolateral fields with 1 + 1 chaetae. Integumentary channels as a paired network on posterior part of the head and a simple channel on anterior part, connection of channels with linea ventralis circular. Chaetae on head and trunk with ordinary shape. All inner chaetae of sensory fields 2-6 short flam-shaped. Dorsal abdominal s-chaetae s2 bean-shaped, absence of dorsal abdominal s-chaetae s3. Abd. I to V terga with 20 + 20 ordinary chaetae. Slightly elongated claws. Tenaculum with 3 + 3 teeth. Abd. IV sternum with 2 + 2 chaetae. Mucro lamellae smooth, moderately enlarged.

Description.

General aspect. Habitus and segmentation typical of the genus. Length from labrum to anus: ~500 μm. Specimens with pale to deep red pigmentation in alcohol. Body chaetotaxy sparse including chaetae, s-chaetae, τ-chaetae as trichobothria, neosminthuroid chaetae, wax rod secretory elements and special swollen chaetae within sf2-6. Length of chaetae ranging from microchaetae [<6 μm] to mesochaetae [6-10 μm] and macrochaetae [11-15 μm]. Chaetae simple, without any remarkable development.

Integument. Secondary granulation made of the usual dorsal rough granules (Fig. 9) and of smooth and flat irregular discoid granules near the ventral, post-labial chaetae of head (Fig. 8C). Integumentary channels extending laterally and dorsally in anterior and posterior part of head (Fig. 8A, B). Posterior channels as a pair of well developed network. The most detailed observation allowed recognition of at least 10 cycles and 11 terminal branches with unclear tips (Fig. 8A). Anterior channel as a simple branch ending near the lateral edge of sf1, touching lateral chaeta of pra.a-row (Figs 8B, 14C). Cephalic channels connection with linea ventralis circular (Figs 8C, 14D). Thoracic channels simple, restricted to ventral part.

Sensory fields and wax rods. A total of 14 + 14 wax rod secretory crypts (2 + 2 on head, 12 + 12 on body), including the ones inserted in each 6 + 6 sensory fields (Figs 8A, B, 9, 14C, 16B). sf1 without inner chaeta (Fig. 8B). Each inner chaeta of sf 2-6 flam-shaped and curved (Figs 8A, 9), the biggest in sf6 (Fig. 9). Inner chaeta of sf6 length: sf6 diameter <0.5. sf2, 6 with one inner chaeta. sf3 with three inner chaetae (Fig. 9). sf4, 5 each with two inner chaetae (Fig. 9). wrc5 adjoining sf5 borders (Fig. 9).

Labrum. Chaetae (Fig. 8D, E): a1, 2 much thicker and longer than chaetae m0-2; m0-2 smooth, a2 with three-four external slender teeth and with inward tip, a1 with three feeble blunt teeth and with outward, flattened tip; m0 almost on the same level than m1. Integumentary crests: m-row distinctly separated from a-row by the antero-median transversal crest (amt); longitudinal crest ml2 apparently not projecting anteriorly. Anterior side of the anterior process with 3 + 3 clear integumentary bulges and one axial, short bulge (Fig. 8E). Anterior process of the labrum not further studied. Ridge of the labrum with three pikes (Fig. 8E).

Other mouth parts. Oral fold with 2 + 2 mesochaetae (Fig. 8C). Maxillary outer lobe: palp with subapical mesochaeta and apical papillate macrochaeta (Fig. 8F, G), edge of apical papilla with weak lobes, sublobal plate with two short hairs (Fig. 8F, G). Basomedian fields of labium with 3 + 3 mesochaetae, basolateral fields of labium with 1 + 1 mesochaetae on tubercle (Fig. 8C, H). Labial palp chaetal equipment typical of the genus, guard hairs strong in regard of papillate chaetae (Fig. 8 H–J). Maxilla as in Fig. 10A, B. Left mandibula with five apical teeth (Fig. 10C), right mandibula with six apical teeth and a double tooth between apex and molar plate (Fig. 10D).

Head chaetotaxy. Dorsally and laterally with mesochaetae, posterior and anterior mesochaetae subequal with a slight trend for posterior chaetae to be stronger than anterior chaetae (Fig. 8A, B). Dorsal anterior area with 11 pairs of chaetae and two axial chaetae (Figs 8B, 14C); with 2 + 2 pseudopore-like elements as ovoid, clear rings between sf1 and insertion of antenna (Figs 8B, 14C). Lateral anterior area with 1 + 1 chaetae (Figs 8B, 14C). Dorsal posterior area with 11 pairs of chaetae (Figs 8A, 14C). Ventral side with three pairs of post-labial macrochaetae (Figs 8C, 14D).

Antennal chaetotaxy. Illustrated in Fig. 10E, F, pattern diagram in Fig. 15 and summarized in Table 1. Ant. I with one mesochaeta. Ant. II with four mesochaetae, anterior chaeta longer than the other. Ant. III with nine mesochaetae, two long S-chaetae (S1, S4) and two short S-chaetae (S2, S3) in a cupule. S2 and S3 clearly protruding from a shallow cupule, only weakly covered by a feeble integumentary lobe. S1-S4 ornamentation unclear in light microscopy. Tip of S1 rising slightly above Ant. IV basal whorl of S-chaetae, tip of S4 rising up to Ant. IV basal whorl of S-chaetae. Ant. IV with twelve S-chaetae (10 S, Sy and Sx), seven ordinary microchaetae, a small organite (Or) apically flared, two apical and subapical rods (a, sa). S-chaetae S with blunt apex, rather short (5-6 μm).

Thoracic terga chaetotaxy. Th. II with 12 + 12 chaetae of variable length, 1 + 1 s-chaetae s1 tubular and curved and 3 + 3 τ-chaetae (Figs 9, 16B). Chaetae including 5 + 5 macrochaetae (a4, a7, a8, p1, p8), 5 + 5 mesochaetae (a1, a2, a3, a9, p2) and 2 + 2 microchaetae (p3, p4) (Fig. 9). Chaeta p4 postero-lateral to sf3 (Figs 9, 16B). Two τ-chaetae in the periphery of sf3, one in posterior position next to p2, one in lateral position and 5-6 granules far from p4 (Figs 9, 16B). Th. III area with 10 + 10 chaetae, 5 + 5 τ-chaetae and 6 + 6 free wax-rod generating crypts (wrc1-6; Figs 9, 16B). Chaetae including 4 + 4 macrochaetae (a6, a8, a9, p7), 4 + 4 mesochaetae (a5, p2, p3, p4) and 2 + 2 microchaetae (a1, a3) (Fig. 9). Chaeta p4 moved posteriorly from wrc2 (Figs 9, 16B). Chaeta a6 slightly bigger than a5 (Fig. 9).

Legs chaetotaxy. Legs with ordinary chaetae of variable size as in Fig. 11 A–C and summarized in Table 2. Subcoxa 1 I with a mesochaeta, coxa I with a microchaeta. Subcoxa 1, 2 II each with a mesochaeta, coxa II with a macrochaeta. Subcoxa 1, 2 III and coxa III with respectively 2, 1, 1 macrochaetae. Anterior and posterior microchaetae present on each pretarsus.

Claws. Ratio unguis length: pretarsus width on leg I–III respectively as 3.2, 2, 1.87, claw I with rather slender morphology, claw III bulkier than claw I and II. Claw I with longer unguis and each claw with subequal length of unguiculus, ratio unguiculus: unguis for claw I, II, III as ~ 0.43, 0.5, 0.5 (Fig. 11 D–I). Unguis basal and posterior auxiliary lamellae (la, lp and Bp) well developed, anterior crest (Ba) clear on claw II and III (Fig. 11F, H), hardly perceptible on claw I. Each unguiculus with a posterior crest Cp, anterior crest Ca short and in basal position on each claw, joining the internal border of the unguiculal lamella on claw III, basal tubercle with posterior lobe not or weakly protruding (Fig. 11 D–J). Ratio unguis length: tibiotarsus length on leg I–III respectively as 1.85, 1.43, 1.47.

Abd. I–V terga chaetotaxy. With a total of 20 + 20 chaetae, 1 + 1 τ-chaetae, 2 + 2 free wax-rod generating crypts (wrc7, 8), 1 + 1 s-chaetae s2 shaped as a bean (Figs 9, 16B). Chaetae including 15 + 15 chaetae rather small and thin (5-7 μm), 5 + 5 stronger chaetae (macrochaetae ε 2, ε 3 = 11-12 μm, mesochaetae ζ 2, η 2, η 3= 9-10 μm). Chaeta α 3 close to wrc7, both clearly anterior to β 3 and β 4 (Figs 9, 16B).

Abd. VI and genital chaetotaxy. Abd. VI: with nine dorsal chaetae (6-7 μm) (Fig. 12A); each anal valve with microchaeta av and several granular crests (four paired plus one axial on dorsal valve, four on each ventral valve); with 7 + 7 ventral chaetae (4-8 μm; Fig. 12A), male with 1 + 1 additional ventral cylindrical swollen chaetae sm (Fig. 12E). Genital plate: female with 2 + 2 microchaetae; male with 9 + 9 microchaetae (Fig. 12E, F).

Abd. IV sternum and furca. Abd. IV sternum with 2 + 2 neosminthuroid chaetae and 2 + 2 posterior mesochaetae (Fig. 12A). Manubrium with 2 + 2 posterior chaetae (Fig. 12A). Proximal subsegment of dens with one posterior chaeta (Fig. 12A); distal subsegment posteriorly with two basal spines, one median chaeta and two apical spines, anteriorly with three apical spines, basal spines without elongated apex, apical spines with elongated apex (longer in posterior spines) (Fig. 12A). Mucro lamellae well developed conferring a slight elliptical shape to the mucro in lateral and dorsal view, with a gradual narrowing in the apical 1/5 (Fig. 12A). Lamellae edges smooth. Ratio dp: dd: mucro = 0.69: 1: 75; ratio mucro width: mucro length ~0.23.

Tenaculum and ventral tube. Tenaculum with 3 + 3 hook-like teeth (Fig. 12 B–D). Ventral tube with two apical pairs of mesochaetae (Fig. 12B).

Affinities.

Megalothorax sanguineus sp. n. has the characteristics of the minimus group species ( Schneider and D’Haese 2013; Papáč and Kováč 2013). Within this group, it differs clearly from Megalothorax sanctistephani and Megalothorax potapovi sp. n. by the absence of a median integumentary structure on forehead. Megalothorax sanguineus is similar to Megalothorax minimus in terms of chaetotaxic pattern on antenna, legs, and trunk terga (without differences in absence/presence of chaetae). It differs from Megalothorax minimus by the shape of the inner chaetae of sf3-7 (some T-shaped in Megalothorax minimus , always flam-shaped in Megalothorax sanguineus sp. n.), the morphology of chaetae in the dorsal posterior area of head, the integumentary pattern, the morphology of labral chaetae, claw and mucro. The deep red pigmentation of Megalothorax sanguineus sp. n. might be similar to that of Megalothorax rubidus (Salmon, 1946), but the two species differ in dental spines morphology (the four posterior spines with elongated apex in Megalothorax rubidus ). Megalothorax sanguineus sp. n. shares morphological trends with Megalothorax aquaticus and Megalothorax granulosus Schneider & D’Haese, 2013: enlargement of mucro lamellae, developed network of integumentary channels on head and elongation of dental spines apex (Stach 1957, Schneider and D’Haese 2013 and pers. obs.). In term of unguis I length: pretarsus I width ratio, it is surpassed by Megalothorax aquaticus (epigeic hygrophilous mountains) and Megalothorax draco Papáč & Kováč, 2013 (troglobiontic), comparable to Megalothorax massoudi Deharveng, 1978 (troglobiontic) and Megalothorax nigropunctatus Schneider and D’Haese, 2013 (epigeic, deadwood dwelling); it surpasses slightly Megalothorax granulosus (epigeic hygrophilous) and more significantly Megalothorax tuberculatus , Megalothorax hipmani Papáč and Kováč 2013 and Megalothorax carpaticus (troglobiontic). In term of absolute size of the unguis I, it is similar to the two later species, surpasses Megalothorax granulosus and is clearly surpassed by Megalothorax nigropunctatus , Megalothorax tuberculatus and Megalothorax massoudi sp. n.

Ecology and distribution.

The species is known from humid micro-habitats in Pyrenees, though it was absent from the Bernadouze peat-bog itself. Other Megalothorax found in moist mosses in mountains are Megalothorax aquaticus (1750m in High Tatras Mountains) (Stach 1957) and Megalothorax minimus (up to 1500m in Pyrenees Mountains) (pers. obs.). The combination of morphological features shared with Megalothorax aquaticus seems to be related to hygrophilous ecology. In that regard, Megalothorax sanguineus sp. n. would remain less morphologically specialized than Megalothorax aquaticus but more than Megalothorax minimus . “Red” Megalothorax are present across the whole Pyrenean range (pers. obs.), and might be Megalothorax sanguineus sp. n., but identification has only been confirmed so far for Ariège and Pyrénées-Atlantique specimens.

Etymology.

Megalothorax sanguineus sp. n. is named after the deep red pigmentation of the species.

DNA barcode.

A 658bp fragment of the COI gene was amplified and sequenced from five specimens from the Saint-Lary locality. Specimens were unfortunately lost, sequences identification is based on consistency between: the peculiar pigmentation of the species observed on specimens before destruction, the genetic similarity of the five specimens and the morphological identification of four other specimens with the same pigmentation from the same sample. The sequences are deposited into the GenBank database under accession numbers JN298074-JN298078.

Four sequences are identical (JN298074-JN298077, provided below), base composition is A = 29.6%, C = 17.5%, G = 15.8%, T = 37.1% (A + T = 66.7%). The fifth sequence (JN298078) differs in 11 sites (= 98.3% pairwise identity), base composition is A = 29.5%, C = 17.6%, G = 15.7%, T = 37.2% (A + T = 66.7%).

5 ’– AACCTTATATTTAATTTTTGGAGTATGATCTGCTATAGTTGGAACAGCATTTAGAGTTTTAATTCGGTTAGAATTAGGACACCCAGGAAGCTTAATTGGAAACGATCAAATCTATAATGTAATAGTTACGGCCCATGCATTTGTAATAATTTTTTTTATAGTAATACCAATAATAATTGGAGGCTTTGGTAATTGATTAGTACCTTTAATAATTGGAGCACCTGATATAGCATTTCCTCGAATAAACAATTTAAGATTCTGACTTTTACCAC CATCTTTAATCTTATTACTATCCAGAGGGTTAGTTGAAACTGGTGCTGGCACAGGATGAACAGTATATCCCCCTCTATCGTCTAATATTTCTCATAGAGGAGCTTCTGTAGATTTAACTATTCTTAGACTTCATTTAGCTGGGATATCTTCTATTCTTGGGGCAATTAATTTTATTACAACTATTCTTAATATACGAATACCAGGAATAACATGAGACCAAACTTCTTTATTTGTATGATCAGTTTTTATTACCTCAATTTTATTACTCCTCTCGCTTCCAGTGCTTGCTGGAGCAATTACTATACTTTTAACTGACCGTAACCTGAATACCTCATTTTTTGATCCTGCGGGAGGAGGAGACCCTATTCTATATCAACATTTATTT –3’.