Terebellides irinae Gagaev, 2009

Barroso, Maria, Moreira, Juan, Capa, Maria, Nygren, Arne & Parapar, Julio, 2022, A further step towards the characterisation of Terebellides (Annelida, Trichobranchidae) diversity in the Northeast Atlantic, with the description of a new species, ZooKeys 1132, pp. 85-126 : 85

publication ID	https://dx.doi.org/10.3897/zookeys.1132.91244
publication LSID	lsid:zoobank.org:pub:4168C32E-37A7-4912-A909-4912E69030AA
persistent identifier	https://treatment.plazi.org/id/A0820D23-7F6D-526D-8A6D-482AA90CF569
treatment provided by	ZooKeys by Pensoft
scientific name	Terebellides irinae Gagaev, 2009
status

Treatment

Figs 3D View Figure 3 , 4C View Figure 4 , 9 View Figure 9 , 10D View Figure 10 , 11 View Figure 11 , 12 View Figure 12 , 13 View Figure 13

Terebellides irinae Gagaev, 2009: 474-478.

Terebellides irinae Species 24 - Nygren et al. 2018: 18-22, figs 6, 10.

Material examined.

6 specimens (Suppl. material 1), Arctic Ocean (ZMBN116496, ZMBN116497, ZMBN116498, ZMBN116499, ZMBN116500, ZMBN116501).

GenBank accession numbers of material examined (COI).

MG025340, MG025341, MG025342, MG025343, MG025344 .

Diagnostic features of studied material.

Incomplete individuals ranging from 10.0-17.0 mm in length (Fig. 9 View Figure 9 ). Branchial dorsal lobes provided with filaments, 75.0 µm in length (Fig. 3D View Figure 3 ) and branchial ventral lobes reduced, distinctly smaller than dorsal ones (Fig. 4C View Figure 4 ). Dorsal lobes provided with seven lamellae (Fig. 4C View Figure 4 ). Lateral lappets present on TC 1-4; dorsal projection of thoracic notopodia on TC 2-5 (Fig. 3D View Figure 3 ). Geniculate chaetae in TC 5, acutely bent and provided with hardly distinguishable capitium (Fig. 13B View Figure 13 ). Ciliated papilla dorsal to thoracic notopodia not observed. From TC 7, neuropodia with one row of type 3 thoracic uncini per torus, with rostrum/capitium length ratio of ~ 2:1 and capitium with a first row of four or five medium-sized teeth, followed by several smaller teeth (Fig. 13C, D View Figure 13 ). Abdomen with at least 20 pairs of neuropodia with type 2 uncini (Fig. 13E, F View Figure 13 ).

Colour pattern.

MG staining pattern characterised by compact green colourant in SG 1-4, then turning into striped pattern in SG 5-14 and fading in following segments (Fig. 12 View Figure 12 ). Similar to pattern 1.

Nucleotide diagnostic features.

All sequences of Terebellides irinae share and are distinguished from other available Terebellides sequences in unique combinations of nucleotides (underlined) at the given position of our alignment: 177-204: CGGGGGGTTTGGAAACTGGTTAATCCCC, 213-225: TGGGGCCCCAGAC, 249-258: CATAAGGTTC, 273-303: GGCCCTCATCCTACTAGTCAGCTCAGCTGCT, 305-321: GGCTGGT, 327-336: ATGAACTGTA, 342-372: ACCACTTTCAGACAACATCGCTCATGCCGGA, 381-399: AGATCTAGCAATTTTCTCA, 426: CCTAGGTTCTATTAACTTCATCACAACAGTC, 483-499: TCTAGAACGAATCCCAC, 535-573: TTATTACTATCACTACCAGTGCTAGCCGGAGCTATTACC, 594-612: CATTAACACATCATTCTTC, 618-636: AGCCGGTGGTGGTGATCCT.

Type locality.

Arctic Ocean, 73°04'N, 157°12'W ( Gagaev 2009).

Distribution and bathymetry.

Arctic Ocean; 4038-4380 m deep (Figs 10D View Figure 10 , 11 View Figure 11 , Suppl. material 1).

Remarks.

Terebellides irinae is a small species, reaching up to 17 mm in length and is characterised by the lack of papillae on margins of branchial lamellae, and by having branchiae of type 4, filaments in ventral branchial lobes, thoracic uncini of type 3 and abdominal uncini of type 2 (Table 1 View Table 1 ). Jirkov and Leontovich (2013) proposed T. irinae as synonym of T. stroemii because it fit within the variability of the latter. However, Parapar and Hutchings (2014) redescribed T. stroemii designating a neotype and T. irinae not fit in this concept. Later, Nygren et al. (2018) recognised T. irinae as different from T. stroemii after molecular analyses and pointed out that T. irinae is the only species present in the Arctic Ocean at depths below 4000 m (Fig. 11 View Figure 11 ). Furthermore, T. irinae is the only species in Northeast Atlantic Ocean bearing branchiae of type 4 and therefore is also considered as a valid species in this work. Other taxa from elsewhere such as T. mira and T. rigel also bear the same branchial type, these two species have branchial lobes free from each other with few numbers of not packed lamellae and ventral lobes are also distinctly smaller than the dorsal ones.